Mutagenetix > Incidental Mutations

Incidental Mutation 'PIT4382001:Baiap2l1'

554677

Institutional Source

Beutler Lab

Gene Symbol

Baiap2l1

Ensembl Gene

ENSMUSG00000038859

Gene Name

BAI1-associated protein 2-like 1

Synonyms

IRTKS, 1300006M19Rik

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

PIT4382001 (G1)

Quality Score

86.0076

Status

Not validated

Chromosome

Chromosomal Location

144264526-144358112 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 144278670 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 342 (K342E)

Ref Sequence

ENSEMBL: ENSMUSP00000053129 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055190] [ENSMUST00000155491]

PDB Structure

Solution Structure of RSGI RUH-010, an SH3 Domain from Mouse cDNA [SOLUTION NMR]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000055190
AA Change: K342E

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000053129
Gene: ENSMUSG00000038859
AA Change: K342E

Domain	Start	End	E-Value	Type
Pfam:IMD	16	236	4.4e-65	PFAM
SH3	343	402	1.42e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000155491

SMART Domains

Protein: ENSMUSP00000122016
Gene: ENSMUSG00000047843

Domain	Start	End	E-Value	Type
Pfam:DUF2367	27	90	1.1e-24	PFAM

Coding Region Coverage

1x: 92.9%
3x: 90.5%
10x: 84.6%
20x: 72.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IMD (IRSp53/MIM homology domain) family. Members of this family can be subdivided in two groups, the IRSp53-like and MIM-like, based on the presence or absence of the SH3 (Src homology 3) domain. The protein encoded by this gene contains a conserved IMD, also known as F-actin bundling domain, at the N-terminus, and a canonical SH3 domain near the C-terminus, so it belongs to the IRSp53-like group. This protein is the substrate for insulin receptor tyrosine kinase and binds to the small GTPase Rac. It is involved in signal transduction pathways that link deformation of the plasma membrane and remodeling of the actin cytoskeleton. It also promotes actin assembly and membrane protrusions when overexpressed in mammalian cells, and is essential to the formation of a potent actin assembly complex during EHEC (Enterohemorrhagic Escherichia coli) pedestal formation. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased circulating glucose and insulin levels, impaired glucose tolerance and insulin resistance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9430038I01Rik	G	T	7: 137,376,982	H144N	unknown	Het
Acsm4	C	T	7: 119,698,575	T145M	probably damaging	Het
Adam10	T	C	9: 70,766,081	L498P	probably damaging	Het
Adgrl2	A	G	3: 148,817,298	L430P		Het
Alk	T	C	17: 71,949,921	M648V	probably benign	Het
Arhgap35	T	C	7: 16,563,869	R424G	possibly damaging	Het
Ccdc54	C	T	16: 50,590,856	V16M	probably damaging	Het
Chil3	T	G	3: 106,148,659	D366A	probably damaging	Het
Chuk	A	G	19: 44,098,607	V151A	probably damaging	Het
Cpd	T	G	11: 76,797,788	H886P	probably benign	Het
Cped1	T	A	6: 22,222,450	C736*	probably null	Het
Creb3l3	T	C	10: 81,084,912	E428G	probably benign	Het
Csad	G	A	15: 102,188,650	L7F	probably benign	Het
Dnah1	C	T	14: 31,284,455	D2255N	probably damaging	Het
Dnajb12	T	C	10: 59,892,686	Y159H	probably damaging	Het
Dpysl4	T	A	7: 139,089,578	Y57*	probably null	Het
F2rl1	T	G	13: 95,513,646	N243H	probably benign	Het
Fhl4	T	C	10: 85,098,429	K163E	possibly damaging	Het
Flot2	T	C	11: 78,053,367	S46P	possibly damaging	Het
Fsip2	C	A	2: 82,990,852	T5643K	possibly damaging	Het
Gm853	A	T	4: 130,219,161	N147K	possibly damaging	Het
Gm8765	A	T	13: 50,700,971	E215V	probably damaging	Het
Golga4	T	A	9: 118,553,453	Y542N	possibly damaging	Het
Il17re	A	G	6: 113,469,077	T426A	probably benign	Het
Kdm2a	T	A	19: 4,343,173	M385L	probably benign	Het
Kdm3b	T	C	18: 34,809,087	S744P	probably damaging	Het
Krtap6-3	T	A	16: 89,084,160	Y26*	probably null	Het
Lama2	T	C	10: 27,204,905	D974G	probably damaging	Het
Lipo5	A	T	19: 33,465,939	L159Q	probably null	Het
Mau2	C	T	8: 70,030,652	E187K	possibly damaging	Het
Mrpl9	T	C	3: 94,447,829	L236P	probably benign	Het
Mta1	A	G	12: 113,133,250	T564A	probably benign	Het
Mylk	C	T	16: 34,875,642	S249L	probably damaging	Het
Ncor1	G	T	11: 62,344,663	T331K	probably damaging	Het
Nsun3	T	A	16: 62,785,865	K15N	probably damaging	Het
Nsun5	A	G	5: 135,371,501	Y132C	probably benign	Het
Obsl1	T	A	1: 75,487,963	T1605S	probably benign	Het
Olfr1463	T	C	19: 13,234,895	I215T	probably damaging	Het
Olfr519	A	G	7: 108,894,102	Y107H	probably damaging	Het
Olfr566	A	G	7: 102,856,602	Y227H	probably damaging	Het
Olfr574	A	T	7: 102,949,449	Y328F	probably benign	Het
Oraov1	T	A	7: 144,916,444	Y37N	probably damaging	Het
P2rx1	A	G	11: 73,009,200	N148D	probably benign	Het
Pogz	T	A	3: 94,879,796	S1232T	probably damaging	Het
Polr3b	C	A	10: 84,684,185	T655N	probably damaging	Het
Prss34	T	C	17: 25,298,908		probably null	Het
Rhpn2	A	G	7: 35,390,753		probably null	Het
Runx1	T	A	16: 92,613,760	D256V	probably damaging	Het
Shc1	C	A	3: 89,427,408	Q525K	probably benign	Het
Slc10a5	T	C	3: 10,335,447	D51G	probably benign	Het
Slc6a3	A	T	13: 73,571,523	N557I	probably benign	Het
Slmap	C	T	14: 26,533,431	R32H	probably damaging	Het
Spata31d1c	T	C	13: 65,036,171	I509T	probably benign	Het
Srr	C	A	11: 74,910,308	V138F	probably benign	Het
Tas2r118	G	A	6: 23,969,786	T92I	possibly damaging	Het
Tcaf2	A	T	6: 42,624,366	*920K	probably null	Het
Tenm2	T	A	11: 36,063,902	Y1141F	probably damaging	Het
Thoc6	T	C	17: 23,668,867	N322S	probably benign	Het
Tlcd2	A	G	11: 75,468,591	I70V	probably benign	Het
Tmem214	A	G	5: 30,871,451	D128G	possibly damaging	Het
Trav13-4-dv7	T	C	14: 53,757,781	V64A	probably benign	Het
Tyro3	T	C	2: 119,802,364	W122R	probably damaging	Het
Ugcg	A	G	4: 59,213,246	D144G	possibly damaging	Het
Uimc1	T	C	13: 55,031,015	D627G	probably benign	Het
Utp6	T	C	11: 79,962,273	I13V	probably benign	Het
Vmn2r99	A	G	17: 19,394,343	K775R	probably damaging	Het
Wdfy3	CG	C	5: 101,882,961		probably null	Het
Zw10	C	T	9: 49,071,644	T525I	probably benign	Het

Other mutations in Baiap2l1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00789:Baiap2l1	APN	5	144285546	nonsense	probably null
IGL00789:Baiap2l1	APN	5	144286069	splice site	probably null
IGL00922:Baiap2l1	APN	5	144318967	missense	probably damaging	1.00
IGL01446:Baiap2l1	APN	5	144275913	missense	probably benign	0.10
IGL01603:Baiap2l1	APN	5	144280815	intron	probably benign
IGL02748:Baiap2l1	APN	5	144266605	intron	probably benign
IGL03348:Baiap2l1	APN	5	144278531	missense	probably benign	0.08
R0066:Baiap2l1	UTSW	5	144284562	missense	probably damaging	1.00
R0066:Baiap2l1	UTSW	5	144284562	missense	probably damaging	1.00
R0110:Baiap2l1	UTSW	5	144275891	missense	probably damaging	1.00
R0197:Baiap2l1	UTSW	5	144266010	missense	probably damaging	0.96
R0469:Baiap2l1	UTSW	5	144275891	missense	probably damaging	1.00
R0744:Baiap2l1	UTSW	5	144266641	missense	probably benign	0.21
R0755:Baiap2l1	UTSW	5	144284557	missense	probably damaging	0.97
R0765:Baiap2l1	UTSW	5	144277703	missense	probably damaging	0.99
R1051:Baiap2l1	UTSW	5	144286133	missense	probably damaging	1.00
R1809:Baiap2l1	UTSW	5	144324555	critical splice donor site	probably null
R3889:Baiap2l1	UTSW	5	144278535	missense	possibly damaging	0.67
R4451:Baiap2l1	UTSW	5	144278552	missense	probably damaging	1.00
R5093:Baiap2l1	UTSW	5	144278553	missense	probably damaging	1.00
R5471:Baiap2l1	UTSW	5	144282141	missense	probably benign	0.01
R5523:Baiap2l1	UTSW	5	144275958	missense	probably damaging	1.00
R5524:Baiap2l1	UTSW	5	144280949	missense	probably benign	0.01
R5586:Baiap2l1	UTSW	5	144282139	missense	probably damaging	0.99
R5603:Baiap2l1	UTSW	5	144265977	missense	probably damaging	1.00
R5735:Baiap2l1	UTSW	5	144286302	missense	probably damaging	1.00
R6353:Baiap2l1	UTSW	5	144282088	missense	possibly damaging	0.80
R6572:Baiap2l1	UTSW	5	144286302	missense	probably damaging	1.00
R6619:Baiap2l1	UTSW	5	144286106	missense	probably benign	0.22
R6981:Baiap2l1	UTSW	5	144285579	missense	possibly damaging	0.94
R7218:Baiap2l1	UTSW	5	144275877	missense	probably benign	0.01
R7352:Baiap2l1	UTSW	5	144324626	missense	probably benign	0.03
R7662:Baiap2l1	UTSW	5	144357890	intron	probably benign
R7797:Baiap2l1	UTSW	5	144318950	missense	probably damaging	1.00
X0022:Baiap2l1	UTSW	5	144278652	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTACAGGAAAGACGGCAGCTC -3'
(R):5'- TCCATAAGGGGATCAGGTAGGC -3'

Sequencing Primer
(F):5'- AGGGCCATTTGAACCTGATGC -3'
(R):5'- TCAGGTAGGCAAGACACAGAAAC -3'

Posted On

2019-06-07