Incidental Mutation 'PIT4382001:Baiap2l1'
ID554677
Institutional Source Beutler Lab
Gene Symbol Baiap2l1
Ensembl Gene ENSMUSG00000038859
Gene NameBAI1-associated protein 2-like 1
SynonymsIRTKS, 1300006M19Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4382001 (G1)
Quality Score86.0076
Status Not validated
Chromosome5
Chromosomal Location144264526-144358112 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 144278670 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 342 (K342E)
Ref Sequence ENSEMBL: ENSMUSP00000053129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055190] [ENSMUST00000155491]
PDB Structure
Solution Structure of RSGI RUH-010, an SH3 Domain from Mouse cDNA [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055190
AA Change: K342E

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000053129
Gene: ENSMUSG00000038859
AA Change: K342E

DomainStartEndE-ValueType
Pfam:IMD 16 236 4.4e-65 PFAM
SH3 343 402 1.42e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155491
SMART Domains Protein: ENSMUSP00000122016
Gene: ENSMUSG00000047843

DomainStartEndE-ValueType
Pfam:DUF2367 27 90 1.1e-24 PFAM
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.5%
  • 10x: 84.6%
  • 20x: 72.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IMD (IRSp53/MIM homology domain) family. Members of this family can be subdivided in two groups, the IRSp53-like and MIM-like, based on the presence or absence of the SH3 (Src homology 3) domain. The protein encoded by this gene contains a conserved IMD, also known as F-actin bundling domain, at the N-terminus, and a canonical SH3 domain near the C-terminus, so it belongs to the IRSp53-like group. This protein is the substrate for insulin receptor tyrosine kinase and binds to the small GTPase Rac. It is involved in signal transduction pathways that link deformation of the plasma membrane and remodeling of the actin cytoskeleton. It also promotes actin assembly and membrane protrusions when overexpressed in mammalian cells, and is essential to the formation of a potent actin assembly complex during EHEC (Enterohemorrhagic Escherichia coli) pedestal formation. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased circulating glucose and insulin levels, impaired glucose tolerance and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430038I01Rik G T 7: 137,376,982 H144N unknown Het
Acsm4 C T 7: 119,698,575 T145M probably damaging Het
Adam10 T C 9: 70,766,081 L498P probably damaging Het
Adgrl2 A G 3: 148,817,298 L430P Het
Alk T C 17: 71,949,921 M648V probably benign Het
Arhgap35 T C 7: 16,563,869 R424G possibly damaging Het
Ccdc54 C T 16: 50,590,856 V16M probably damaging Het
Chil3 T G 3: 106,148,659 D366A probably damaging Het
Chuk A G 19: 44,098,607 V151A probably damaging Het
Cpd T G 11: 76,797,788 H886P probably benign Het
Cped1 T A 6: 22,222,450 C736* probably null Het
Creb3l3 T C 10: 81,084,912 E428G probably benign Het
Csad G A 15: 102,188,650 L7F probably benign Het
Dnah1 C T 14: 31,284,455 D2255N probably damaging Het
Dnajb12 T C 10: 59,892,686 Y159H probably damaging Het
Dpysl4 T A 7: 139,089,578 Y57* probably null Het
F2rl1 T G 13: 95,513,646 N243H probably benign Het
Fhl4 T C 10: 85,098,429 K163E possibly damaging Het
Flot2 T C 11: 78,053,367 S46P possibly damaging Het
Fsip2 C A 2: 82,990,852 T5643K possibly damaging Het
Gm853 A T 4: 130,219,161 N147K possibly damaging Het
Gm8765 A T 13: 50,700,971 E215V probably damaging Het
Golga4 T A 9: 118,553,453 Y542N possibly damaging Het
Il17re A G 6: 113,469,077 T426A probably benign Het
Kdm2a T A 19: 4,343,173 M385L probably benign Het
Kdm3b T C 18: 34,809,087 S744P probably damaging Het
Krtap6-3 T A 16: 89,084,160 Y26* probably null Het
Lama2 T C 10: 27,204,905 D974G probably damaging Het
Lipo5 A T 19: 33,465,939 L159Q probably null Het
Mau2 C T 8: 70,030,652 E187K possibly damaging Het
Mrpl9 T C 3: 94,447,829 L236P probably benign Het
Mta1 A G 12: 113,133,250 T564A probably benign Het
Mylk C T 16: 34,875,642 S249L probably damaging Het
Ncor1 G T 11: 62,344,663 T331K probably damaging Het
Nsun3 T A 16: 62,785,865 K15N probably damaging Het
Nsun5 A G 5: 135,371,501 Y132C probably benign Het
Obsl1 T A 1: 75,487,963 T1605S probably benign Het
Olfr1463 T C 19: 13,234,895 I215T probably damaging Het
Olfr519 A G 7: 108,894,102 Y107H probably damaging Het
Olfr566 A G 7: 102,856,602 Y227H probably damaging Het
Olfr574 A T 7: 102,949,449 Y328F probably benign Het
Oraov1 T A 7: 144,916,444 Y37N probably damaging Het
P2rx1 A G 11: 73,009,200 N148D probably benign Het
Pogz T A 3: 94,879,796 S1232T probably damaging Het
Polr3b C A 10: 84,684,185 T655N probably damaging Het
Prss34 T C 17: 25,298,908 probably null Het
Rhpn2 A G 7: 35,390,753 probably null Het
Runx1 T A 16: 92,613,760 D256V probably damaging Het
Shc1 C A 3: 89,427,408 Q525K probably benign Het
Slc10a5 T C 3: 10,335,447 D51G probably benign Het
Slc6a3 A T 13: 73,571,523 N557I probably benign Het
Slmap C T 14: 26,533,431 R32H probably damaging Het
Spata31d1c T C 13: 65,036,171 I509T probably benign Het
Srr C A 11: 74,910,308 V138F probably benign Het
Tas2r118 G A 6: 23,969,786 T92I possibly damaging Het
Tcaf2 A T 6: 42,624,366 *920K probably null Het
Tenm2 T A 11: 36,063,902 Y1141F probably damaging Het
Thoc6 T C 17: 23,668,867 N322S probably benign Het
Tlcd2 A G 11: 75,468,591 I70V probably benign Het
Tmem214 A G 5: 30,871,451 D128G possibly damaging Het
Trav13-4-dv7 T C 14: 53,757,781 V64A probably benign Het
Tyro3 T C 2: 119,802,364 W122R probably damaging Het
Ugcg A G 4: 59,213,246 D144G possibly damaging Het
Uimc1 T C 13: 55,031,015 D627G probably benign Het
Utp6 T C 11: 79,962,273 I13V probably benign Het
Vmn2r99 A G 17: 19,394,343 K775R probably damaging Het
Wdfy3 CG C 5: 101,882,961 probably null Het
Zw10 C T 9: 49,071,644 T525I probably benign Het
Other mutations in Baiap2l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00789:Baiap2l1 APN 5 144285546 nonsense probably null
IGL00789:Baiap2l1 APN 5 144286069 splice site probably null
IGL00922:Baiap2l1 APN 5 144318967 missense probably damaging 1.00
IGL01446:Baiap2l1 APN 5 144275913 missense probably benign 0.10
IGL01603:Baiap2l1 APN 5 144280815 intron probably benign
IGL02748:Baiap2l1 APN 5 144266605 intron probably benign
IGL03348:Baiap2l1 APN 5 144278531 missense probably benign 0.08
R0066:Baiap2l1 UTSW 5 144284562 missense probably damaging 1.00
R0066:Baiap2l1 UTSW 5 144284562 missense probably damaging 1.00
R0110:Baiap2l1 UTSW 5 144275891 missense probably damaging 1.00
R0197:Baiap2l1 UTSW 5 144266010 missense probably damaging 0.96
R0469:Baiap2l1 UTSW 5 144275891 missense probably damaging 1.00
R0744:Baiap2l1 UTSW 5 144266641 missense probably benign 0.21
R0755:Baiap2l1 UTSW 5 144284557 missense probably damaging 0.97
R0765:Baiap2l1 UTSW 5 144277703 missense probably damaging 0.99
R1051:Baiap2l1 UTSW 5 144286133 missense probably damaging 1.00
R1809:Baiap2l1 UTSW 5 144324555 critical splice donor site probably null
R3889:Baiap2l1 UTSW 5 144278535 missense possibly damaging 0.67
R4451:Baiap2l1 UTSW 5 144278552 missense probably damaging 1.00
R5093:Baiap2l1 UTSW 5 144278553 missense probably damaging 1.00
R5471:Baiap2l1 UTSW 5 144282141 missense probably benign 0.01
R5523:Baiap2l1 UTSW 5 144275958 missense probably damaging 1.00
R5524:Baiap2l1 UTSW 5 144280949 missense probably benign 0.01
R5586:Baiap2l1 UTSW 5 144282139 missense probably damaging 0.99
R5603:Baiap2l1 UTSW 5 144265977 missense probably damaging 1.00
R5735:Baiap2l1 UTSW 5 144286302 missense probably damaging 1.00
R6353:Baiap2l1 UTSW 5 144282088 missense possibly damaging 0.80
R6572:Baiap2l1 UTSW 5 144286302 missense probably damaging 1.00
R6619:Baiap2l1 UTSW 5 144286106 missense probably benign 0.22
R6981:Baiap2l1 UTSW 5 144285579 missense possibly damaging 0.94
R7218:Baiap2l1 UTSW 5 144275877 missense probably benign 0.01
R7352:Baiap2l1 UTSW 5 144324626 missense probably benign 0.03
X0022:Baiap2l1 UTSW 5 144278652 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTACAGGAAAGACGGCAGCTC -3'
(R):5'- TCCATAAGGGGATCAGGTAGGC -3'

Sequencing Primer
(F):5'- AGGGCCATTTGAACCTGATGC -3'
(R):5'- TCAGGTAGGCAAGACACAGAAAC -3'
Posted On2019-06-07