Incidental Mutation 'PIT4382001:Dpysl4'
ID 554689
Institutional Source Beutler Lab
Gene Symbol Dpysl4
Ensembl Gene ENSMUSG00000025478
Gene Name dihydropyrimidinase-like 4
Synonyms CRMP-3, Crmp3, DPY4, unc-33-like phosphoprotein 4, Drp-4, Ulip4
Accession Numbers
Essential gene? Probably non essential (E-score: 0.078) question?
Stock # PIT4382001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 138665917-138681711 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 138669494 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 57 (Y57*)
Ref Sequence ENSEMBL: ENSMUSP00000112896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026551] [ENSMUST00000121184] [ENSMUST00000145499]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000026551
AA Change: Y36*
SMART Domains Protein: ENSMUSP00000026551
Gene: ENSMUSG00000025478
AA Change: Y36*

DomainStartEndE-ValueType
Pfam:Amidohydro_1 64 453 4.5e-40 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000121184
AA Change: Y57*
SMART Domains Protein: ENSMUSP00000112896
Gene: ENSMUSG00000025478
AA Change: Y57*

DomainStartEndE-ValueType
Pfam:Amidohydro_1 85 474 1.1e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145499
SMART Domains Protein: ENSMUSP00000117764
Gene: ENSMUSG00000025478

DomainStartEndE-ValueType
Pfam:Amidohydro_1 1 148 2.7e-13 PFAM
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.5%
  • 10x: 84.6%
  • 20x: 72.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit abnormal neurite outgrowth and lamination in the hippocampus, altered dendrite arborization and spine morphology in hippocampal pyramidal cells, and impaired LTP induction in the CA1 region. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430038I01Rik G T 7: 136,978,711 (GRCm39) H144N unknown Het
Acsm4 C T 7: 119,297,798 (GRCm39) T145M probably damaging Het
Adam10 T C 9: 70,673,363 (GRCm39) L498P probably damaging Het
Adgrl2 A G 3: 148,522,934 (GRCm39) L430P Het
Alk T C 17: 72,256,916 (GRCm39) M648V probably benign Het
Arhgap35 T C 7: 16,297,794 (GRCm39) R424G possibly damaging Het
Baiap2l1 T C 5: 144,215,480 (GRCm39) K342E possibly damaging Het
Ccdc54 C T 16: 50,411,219 (GRCm39) V16M probably damaging Het
Chil3 T G 3: 106,055,975 (GRCm39) D366A probably damaging Het
Chuk A G 19: 44,087,046 (GRCm39) V151A probably damaging Het
Cpd T G 11: 76,688,614 (GRCm39) H886P probably benign Het
Cped1 T A 6: 22,222,449 (GRCm39) C736* probably null Het
Creb3l3 T C 10: 80,920,746 (GRCm39) E428G probably benign Het
Csad G A 15: 102,097,085 (GRCm39) L7F probably benign Het
Dnah1 C T 14: 31,006,412 (GRCm39) D2255N probably damaging Het
Dnajb12 T C 10: 59,728,508 (GRCm39) Y159H probably damaging Het
F2rl1 T G 13: 95,650,154 (GRCm39) N243H probably benign Het
Fhl4 T C 10: 84,934,293 (GRCm39) K163E possibly damaging Het
Flot2 T C 11: 77,944,193 (GRCm39) S46P possibly damaging Het
Fsip2 C A 2: 82,821,196 (GRCm39) T5643K possibly damaging Het
Golga4 T A 9: 118,382,521 (GRCm39) Y542N possibly damaging Het
Il17re A G 6: 113,446,038 (GRCm39) T426A probably benign Het
Kdm2a T A 19: 4,393,201 (GRCm39) M385L probably benign Het
Kdm3b T C 18: 34,942,140 (GRCm39) S744P probably damaging Het
Krtap20-1 T A 16: 88,881,048 (GRCm39) Y26* probably null Het
Lama2 T C 10: 27,080,901 (GRCm39) D974G probably damaging Het
Ldc1 A T 4: 130,112,954 (GRCm39) N147K possibly damaging Het
Lipo5 A T 19: 33,443,339 (GRCm39) L159Q probably null Het
LTO1 T A 7: 144,470,181 (GRCm39) Y37N probably damaging Het
Mau2 C T 8: 70,483,302 (GRCm39) E187K possibly damaging Het
Mrpl9 T C 3: 94,355,136 (GRCm39) L236P probably benign Het
Mta1 A G 12: 113,096,870 (GRCm39) T564A probably benign Het
Mylk C T 16: 34,696,012 (GRCm39) S249L probably damaging Het
Ncor1 G T 11: 62,235,489 (GRCm39) T331K probably damaging Het
Nsun3 T A 16: 62,606,228 (GRCm39) K15N probably damaging Het
Nsun5 A G 5: 135,400,355 (GRCm39) Y132C probably benign Het
Obsl1 T A 1: 75,464,607 (GRCm39) T1605S probably benign Het
Or10a3n A G 7: 108,493,309 (GRCm39) Y107H probably damaging Het
Or51f1 A G 7: 102,505,809 (GRCm39) Y227H probably damaging Het
Or51t4 A T 7: 102,598,656 (GRCm39) Y328F probably benign Het
Or5b109 T C 19: 13,212,259 (GRCm39) I215T probably damaging Het
P2rx1 A G 11: 72,900,026 (GRCm39) N148D probably benign Het
Pogz T A 3: 94,787,107 (GRCm39) S1232T probably damaging Het
Polr3b C A 10: 84,520,049 (GRCm39) T655N probably damaging Het
Prss34 T C 17: 25,517,882 (GRCm39) probably null Het
Rhpn2 A G 7: 35,090,178 (GRCm39) probably null Het
Runx1 T A 16: 92,410,648 (GRCm39) D256V probably damaging Het
Shc1 C A 3: 89,334,715 (GRCm39) Q525K probably benign Het
Slc10a5 T C 3: 10,400,507 (GRCm39) D51G probably benign Het
Slc6a3 A T 13: 73,719,642 (GRCm39) N557I probably benign Het
Slmap C T 14: 26,254,586 (GRCm39) R32H probably damaging Het
Spata31d1c T C 13: 65,183,985 (GRCm39) I509T probably benign Het
Spata31e4 A T 13: 50,855,007 (GRCm39) E215V probably damaging Het
Srr C A 11: 74,801,134 (GRCm39) V138F probably benign Het
Tas2r118 G A 6: 23,969,785 (GRCm39) T92I possibly damaging Het
Tcaf2 A T 6: 42,601,300 (GRCm39) *920K probably null Het
Tenm2 T A 11: 35,954,729 (GRCm39) Y1141F probably damaging Het
Thoc6 T C 17: 23,887,841 (GRCm39) N322S probably benign Het
Tlcd2 A G 11: 75,359,417 (GRCm39) I70V probably benign Het
Tmem214 A G 5: 31,028,795 (GRCm39) D128G possibly damaging Het
Trav13d-4 T C 14: 53,995,238 (GRCm39) V64A probably benign Het
Tyro3 T C 2: 119,632,845 (GRCm39) W122R probably damaging Het
Ugcg A G 4: 59,213,246 (GRCm39) D144G possibly damaging Het
Uimc1 T C 13: 55,178,828 (GRCm39) D627G probably benign Het
Utp6 T C 11: 79,853,099 (GRCm39) I13V probably benign Het
Vmn2r99 A G 17: 19,614,605 (GRCm39) K775R probably damaging Het
Wdfy3 CG C 5: 102,030,827 (GRCm39) probably null Het
Zw10 C T 9: 48,982,944 (GRCm39) T525I probably benign Het
Other mutations in Dpysl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Dpysl4 APN 7 138,676,092 (GRCm39) missense probably damaging 1.00
IGL01836:Dpysl4 APN 7 138,676,089 (GRCm39) missense possibly damaging 0.96
IGL02447:Dpysl4 APN 7 138,678,516 (GRCm39) missense probably damaging 1.00
IGL02515:Dpysl4 APN 7 138,676,651 (GRCm39) missense probably damaging 1.00
IGL03169:Dpysl4 APN 7 138,679,826 (GRCm39) splice site probably null
R0012:Dpysl4 UTSW 7 138,677,799 (GRCm39) missense probably benign 0.32
R0012:Dpysl4 UTSW 7 138,677,799 (GRCm39) missense probably benign 0.32
R1624:Dpysl4 UTSW 7 138,669,469 (GRCm39) missense probably damaging 1.00
R1642:Dpysl4 UTSW 7 138,670,254 (GRCm39) missense probably damaging 1.00
R1860:Dpysl4 UTSW 7 138,670,215 (GRCm39) missense probably benign
R1885:Dpysl4 UTSW 7 138,676,723 (GRCm39) missense probably damaging 1.00
R1995:Dpysl4 UTSW 7 138,676,686 (GRCm39) missense probably benign
R2698:Dpysl4 UTSW 7 138,676,681 (GRCm39) missense probably damaging 1.00
R3032:Dpysl4 UTSW 7 138,676,152 (GRCm39) missense probably benign 0.01
R3762:Dpysl4 UTSW 7 138,676,672 (GRCm39) missense probably damaging 1.00
R3851:Dpysl4 UTSW 7 138,680,851 (GRCm39) missense probably damaging 1.00
R3852:Dpysl4 UTSW 7 138,680,851 (GRCm39) missense probably damaging 1.00
R4609:Dpysl4 UTSW 7 138,678,537 (GRCm39) missense probably damaging 0.99
R4972:Dpysl4 UTSW 7 138,670,206 (GRCm39) missense probably damaging 1.00
R5538:Dpysl4 UTSW 7 138,671,906 (GRCm39) missense probably benign
R5608:Dpysl4 UTSW 7 138,678,459 (GRCm39) missense probably damaging 0.97
R5762:Dpysl4 UTSW 7 138,671,853 (GRCm39) missense probably benign
R5887:Dpysl4 UTSW 7 138,676,192 (GRCm39) missense possibly damaging 0.72
R6022:Dpysl4 UTSW 7 138,666,000 (GRCm39) unclassified probably benign
R6060:Dpysl4 UTSW 7 138,669,324 (GRCm39) start codon destroyed probably null
R6180:Dpysl4 UTSW 7 138,670,250 (GRCm39) missense probably damaging 1.00
R6328:Dpysl4 UTSW 7 138,679,734 (GRCm39) missense probably benign
R6809:Dpysl4 UTSW 7 138,673,576 (GRCm39) missense probably benign 0.19
R6949:Dpysl4 UTSW 7 138,671,915 (GRCm39) missense probably damaging 1.00
R7647:Dpysl4 UTSW 7 138,679,689 (GRCm39) missense possibly damaging 0.92
R7695:Dpysl4 UTSW 7 138,666,039 (GRCm39) start codon destroyed probably null 0.00
R7751:Dpysl4 UTSW 7 138,669,456 (GRCm39) missense probably benign
R8129:Dpysl4 UTSW 7 138,666,076 (GRCm39) missense probably benign 0.04
R9538:Dpysl4 UTSW 7 138,670,230 (GRCm39) missense probably damaging 1.00
Z1189:Dpysl4 UTSW 7 138,669,324 (GRCm39) start codon destroyed probably null
Z1192:Dpysl4 UTSW 7 138,669,324 (GRCm39) start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- CTGAGTATCCCGCTTTGGAG -3'
(R):5'- TTATCCGGCAAGACTATCGAG -3'

Sequencing Primer
(F):5'- CGCTTTGGAGTACTATCAACAC -3'
(R):5'- GTCTCAAGGACGGTTCCCAG -3'
Posted On 2019-06-07