Incidental Mutation 'PIT4382001:Zw10'
ID554692
Institutional Source Beutler Lab
Gene Symbol Zw10
Ensembl Gene ENSMUSG00000032264
Gene Namezw10 kinetochore protein
SynonymsMmZw10, 6330566F14Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #PIT4382001 (G1)
Quality Score194.009
Status Not validated
Chromosome9
Chromosomal Location49055613-49078775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 49071644 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 525 (T525I)
Ref Sequence ENSEMBL: ENSMUSP00000034803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034803]
Predicted Effect probably benign
Transcript: ENSMUST00000034803
AA Change: T525I

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000034803
Gene: ENSMUSG00000032264
AA Change: T525I

DomainStartEndE-ValueType
Pfam:Zw10 9 621 2.1e-249 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213787
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.5%
  • 10x: 84.6%
  • 20x: 72.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is one of many involved in mechanisms to ensure proper chromosome segregation during cell division. This protein is an essential component of the mitotic checkpoint, which prevents cells from prematurely exiting mitosis. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430038I01Rik G T 7: 137,376,982 H144N unknown Het
Acsm4 C T 7: 119,698,575 T145M probably damaging Het
Adam10 T C 9: 70,766,081 L498P probably damaging Het
Adgrl2 A G 3: 148,817,298 L430P Het
Alk T C 17: 71,949,921 M648V probably benign Het
Arhgap35 T C 7: 16,563,869 R424G possibly damaging Het
Baiap2l1 T C 5: 144,278,670 K342E possibly damaging Het
Ccdc54 C T 16: 50,590,856 V16M probably damaging Het
Chil3 T G 3: 106,148,659 D366A probably damaging Het
Chuk A G 19: 44,098,607 V151A probably damaging Het
Cpd T G 11: 76,797,788 H886P probably benign Het
Cped1 T A 6: 22,222,450 C736* probably null Het
Creb3l3 T C 10: 81,084,912 E428G probably benign Het
Csad G A 15: 102,188,650 L7F probably benign Het
Dnah1 C T 14: 31,284,455 D2255N probably damaging Het
Dnajb12 T C 10: 59,892,686 Y159H probably damaging Het
Dpysl4 T A 7: 139,089,578 Y57* probably null Het
F2rl1 T G 13: 95,513,646 N243H probably benign Het
Fhl4 T C 10: 85,098,429 K163E possibly damaging Het
Flot2 T C 11: 78,053,367 S46P possibly damaging Het
Fsip2 C A 2: 82,990,852 T5643K possibly damaging Het
Gm853 A T 4: 130,219,161 N147K possibly damaging Het
Gm8765 A T 13: 50,700,971 E215V probably damaging Het
Golga4 T A 9: 118,553,453 Y542N possibly damaging Het
Il17re A G 6: 113,469,077 T426A probably benign Het
Kdm2a T A 19: 4,343,173 M385L probably benign Het
Kdm3b T C 18: 34,809,087 S744P probably damaging Het
Krtap6-3 T A 16: 89,084,160 Y26* probably null Het
Lama2 T C 10: 27,204,905 D974G probably damaging Het
Lipo5 A T 19: 33,465,939 L159Q probably null Het
Mau2 C T 8: 70,030,652 E187K possibly damaging Het
Mrpl9 T C 3: 94,447,829 L236P probably benign Het
Mta1 A G 12: 113,133,250 T564A probably benign Het
Mylk C T 16: 34,875,642 S249L probably damaging Het
Ncor1 G T 11: 62,344,663 T331K probably damaging Het
Nsun3 T A 16: 62,785,865 K15N probably damaging Het
Nsun5 A G 5: 135,371,501 Y132C probably benign Het
Obsl1 T A 1: 75,487,963 T1605S probably benign Het
Olfr1463 T C 19: 13,234,895 I215T probably damaging Het
Olfr519 A G 7: 108,894,102 Y107H probably damaging Het
Olfr566 A G 7: 102,856,602 Y227H probably damaging Het
Olfr574 A T 7: 102,949,449 Y328F probably benign Het
Oraov1 T A 7: 144,916,444 Y37N probably damaging Het
P2rx1 A G 11: 73,009,200 N148D probably benign Het
Pogz T A 3: 94,879,796 S1232T probably damaging Het
Polr3b C A 10: 84,684,185 T655N probably damaging Het
Prss34 T C 17: 25,298,908 probably null Het
Rhpn2 A G 7: 35,390,753 probably null Het
Runx1 T A 16: 92,613,760 D256V probably damaging Het
Shc1 C A 3: 89,427,408 Q525K probably benign Het
Slc10a5 T C 3: 10,335,447 D51G probably benign Het
Slc6a3 A T 13: 73,571,523 N557I probably benign Het
Slmap C T 14: 26,533,431 R32H probably damaging Het
Spata31d1c T C 13: 65,036,171 I509T probably benign Het
Srr C A 11: 74,910,308 V138F probably benign Het
Tas2r118 G A 6: 23,969,786 T92I possibly damaging Het
Tcaf2 A T 6: 42,624,366 *920K probably null Het
Tenm2 T A 11: 36,063,902 Y1141F probably damaging Het
Thoc6 T C 17: 23,668,867 N322S probably benign Het
Tlcd2 A G 11: 75,468,591 I70V probably benign Het
Tmem214 A G 5: 30,871,451 D128G possibly damaging Het
Trav13-4-dv7 T C 14: 53,757,781 V64A probably benign Het
Tyro3 T C 2: 119,802,364 W122R probably damaging Het
Ugcg A G 4: 59,213,246 D144G possibly damaging Het
Uimc1 T C 13: 55,031,015 D627G probably benign Het
Utp6 T C 11: 79,962,273 I13V probably benign Het
Vmn2r99 A G 17: 19,394,343 K775R probably damaging Het
Wdfy3 CG C 5: 101,882,961 probably null Het
Other mutations in Zw10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01778:Zw10 APN 9 49069615 missense probably benign
IGL02111:Zw10 APN 9 49068754 missense probably damaging 0.98
IGL02673:Zw10 APN 9 49077593 unclassified probably null
R0402:Zw10 UTSW 9 49068723 missense probably benign 0.00
R0736:Zw10 UTSW 9 49064132 missense probably benign 0.00
R1830:Zw10 UTSW 9 49069741 missense probably damaging 1.00
R1966:Zw10 UTSW 9 49068833 missense probably damaging 1.00
R2231:Zw10 UTSW 9 49064121 missense possibly damaging 0.79
R2474:Zw10 UTSW 9 49066805 missense probably damaging 1.00
R2849:Zw10 UTSW 9 49057641 critical splice acceptor site probably null
R3162:Zw10 UTSW 9 49077560 missense probably damaging 0.98
R3162:Zw10 UTSW 9 49077560 missense probably damaging 0.98
R4893:Zw10 UTSW 9 49074025 missense possibly damaging 0.58
R4927:Zw10 UTSW 9 49068683 missense probably damaging 1.00
R5070:Zw10 UTSW 9 49077459 nonsense probably null
R5214:Zw10 UTSW 9 49064163 missense possibly damaging 0.91
R5637:Zw10 UTSW 9 49057650 missense probably damaging 1.00
R5983:Zw10 UTSW 9 49077445 unclassified probably null
R6368:Zw10 UTSW 9 49073235 missense probably damaging 1.00
R6605:Zw10 UTSW 9 49069626 missense probably benign 0.00
R7221:Zw10 UTSW 9 49069712 missense probably benign 0.00
R7292:Zw10 UTSW 9 49061191 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCTTTCCTGCAGTGACCAAG -3'
(R):5'- GACACAGTTCTTTTGAGCTTCTAAG -3'

Sequencing Primer
(F):5'- TGCAGTGACCAAGGCGTG -3'
(R):5'- AAGTGTATGCTATCTTCCTACACAC -3'
Posted On2019-06-07