Mutagenetix > Incidental Mutations

Incidental Mutation 'PIT4382001:Golga4'

554694

Institutional Source

Beutler Lab

Gene Symbol

Golga4

Ensembl Gene

ENSMUSG00000038708

Gene Name

golgi autoantigen, golgin subfamily a, 4

Synonyms

golgin-245, Olp-1

Accession Numbers

Genbank: NM_018748; MGI: 1859646

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

PIT4382001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

118506267-118582519 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 118553453 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 542 (Y542N)

Ref Sequence

ENSEMBL: ENSMUSP00000081880 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084820] [ENSMUST00000212097] [ENSMUST00000212461]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000084820
AA Change: Y542N

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000081880
Gene: ENSMUSG00000038708
AA Change: Y542N

Domain	Start	End	E-Value	Type
low complexity region	10	41	N/A	INTRINSIC
coiled coil region	157	241	N/A	INTRINSIC
internal_repeat_1	271	299	2.93e-5	PROSPERO
low complexity region	339	351	N/A	INTRINSIC
low complexity region	513	532	N/A	INTRINSIC
low complexity region	547	566	N/A	INTRINSIC
low complexity region	705	715	N/A	INTRINSIC
low complexity region	739	755	N/A	INTRINSIC
low complexity region	882	895	N/A	INTRINSIC
SCOP:d1epua_	940	1076	2e-3	SMART
low complexity region	1138	1152	N/A	INTRINSIC
low complexity region	1161	1182	N/A	INTRINSIC
low complexity region	1204	1228	N/A	INTRINSIC
coiled coil region	1283	1496	N/A	INTRINSIC
internal_repeat_2	1500	1525	5.98e-5	PROSPERO
coiled coil region	1541	1715	N/A	INTRINSIC
low complexity region	1756	1778	N/A	INTRINSIC
internal_repeat_1	1811	1839	2.93e-5	PROSPERO
coiled coil region	1844	1883	N/A	INTRINSIC
internal_repeat_2	1899	1924	5.98e-5	PROSPERO
coiled coil region	1933	2160	N/A	INTRINSIC
Grip	2181	2225	1.38e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000211840

Predicted Effect

possibly damaging
Transcript: ENSMUST00000212097
AA Change: Y514N

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)

Predicted Effect

probably benign
Transcript: ENSMUST00000212183

Predicted Effect

probably benign
Transcript: ENSMUST00000212461

Coding Region Coverage

1x: 92.9%
3x: 90.5%
10x: 84.6%
20x: 72.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This protein has been postulated to play a role in Rab6-regulated membrane-tethering events in the Golgi apparatus. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]

Allele List at MGI

All alleles(32) : Gene trapped(32)

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9430038I01Rik	G	T	7: 137,376,982	H144N	unknown	Het
Acsm4	C	T	7: 119,698,575	T145M	probably damaging	Het
Adam10	T	C	9: 70,766,081	L498P	probably damaging	Het
Adgrl2	A	G	3: 148,817,298	L430P		Het
Alk	T	C	17: 71,949,921	M648V	probably benign	Het
Arhgap35	T	C	7: 16,563,869	R424G	possibly damaging	Het
Baiap2l1	T	C	5: 144,278,670	K342E	possibly damaging	Het
Ccdc54	C	T	16: 50,590,856	V16M	probably damaging	Het
Chil3	T	G	3: 106,148,659	D366A	probably damaging	Het
Chuk	A	G	19: 44,098,607	V151A	probably damaging	Het
Cpd	T	G	11: 76,797,788	H886P	probably benign	Het
Cped1	T	A	6: 22,222,450	C736*	probably null	Het
Creb3l3	T	C	10: 81,084,912	E428G	probably benign	Het
Csad	G	A	15: 102,188,650	L7F	probably benign	Het
Dnah1	C	T	14: 31,284,455	D2255N	probably damaging	Het
Dnajb12	T	C	10: 59,892,686	Y159H	probably damaging	Het
Dpysl4	T	A	7: 139,089,578	Y57*	probably null	Het
F2rl1	T	G	13: 95,513,646	N243H	probably benign	Het
Fhl4	T	C	10: 85,098,429	K163E	possibly damaging	Het
Flot2	T	C	11: 78,053,367	S46P	possibly damaging	Het
Fsip2	C	A	2: 82,990,852	T5643K	possibly damaging	Het
Gm853	A	T	4: 130,219,161	N147K	possibly damaging	Het
Gm8765	A	T	13: 50,700,971	E215V	probably damaging	Het
Il17re	A	G	6: 113,469,077	T426A	probably benign	Het
Kdm2a	T	A	19: 4,343,173	M385L	probably benign	Het
Kdm3b	T	C	18: 34,809,087	S744P	probably damaging	Het
Krtap6-3	T	A	16: 89,084,160	Y26*	probably null	Het
Lama2	T	C	10: 27,204,905	D974G	probably damaging	Het
Lipo5	A	T	19: 33,465,939	L159Q	probably null	Het
Mau2	C	T	8: 70,030,652	E187K	possibly damaging	Het
Mrpl9	T	C	3: 94,447,829	L236P	probably benign	Het
Mta1	A	G	12: 113,133,250	T564A	probably benign	Het
Mylk	C	T	16: 34,875,642	S249L	probably damaging	Het
Ncor1	G	T	11: 62,344,663	T331K	probably damaging	Het
Nsun3	T	A	16: 62,785,865	K15N	probably damaging	Het
Nsun5	A	G	5: 135,371,501	Y132C	probably benign	Het
Obsl1	T	A	1: 75,487,963	T1605S	probably benign	Het
Olfr1463	T	C	19: 13,234,895	I215T	probably damaging	Het
Olfr519	A	G	7: 108,894,102	Y107H	probably damaging	Het
Olfr566	A	G	7: 102,856,602	Y227H	probably damaging	Het
Olfr574	A	T	7: 102,949,449	Y328F	probably benign	Het
Oraov1	T	A	7: 144,916,444	Y37N	probably damaging	Het
P2rx1	A	G	11: 73,009,200	N148D	probably benign	Het
Pogz	T	A	3: 94,879,796	S1232T	probably damaging	Het
Polr3b	C	A	10: 84,684,185	T655N	probably damaging	Het
Prss34	T	C	17: 25,298,908		probably null	Het
Rhpn2	A	G	7: 35,390,753		probably null	Het
Runx1	T	A	16: 92,613,760	D256V	probably damaging	Het
Shc1	C	A	3: 89,427,408	Q525K	probably benign	Het
Slc10a5	T	C	3: 10,335,447	D51G	probably benign	Het
Slc6a3	A	T	13: 73,571,523	N557I	probably benign	Het
Slmap	C	T	14: 26,533,431	R32H	probably damaging	Het
Spata31d1c	T	C	13: 65,036,171	I509T	probably benign	Het
Srr	C	A	11: 74,910,308	V138F	probably benign	Het
Tas2r118	G	A	6: 23,969,786	T92I	possibly damaging	Het
Tcaf2	A	T	6: 42,624,366	*920K	probably null	Het
Tenm2	T	A	11: 36,063,902	Y1141F	probably damaging	Het
Thoc6	T	C	17: 23,668,867	N322S	probably benign	Het
Tlcd2	A	G	11: 75,468,591	I70V	probably benign	Het
Tmem214	A	G	5: 30,871,451	D128G	possibly damaging	Het
Trav13-4-dv7	T	C	14: 53,757,781	V64A	probably benign	Het
Tyro3	T	C	2: 119,802,364	W122R	probably damaging	Het
Ugcg	A	G	4: 59,213,246	D144G	possibly damaging	Het
Uimc1	T	C	13: 55,031,015	D627G	probably benign	Het
Utp6	T	C	11: 79,962,273	I13V	probably benign	Het
Vmn2r99	A	G	17: 19,394,343	K775R	probably damaging	Het
Wdfy3	CG	C	5: 101,882,961		probably null	Het
Zw10	C	T	9: 49,071,644	T525I	probably benign	Het

Other mutations in Golga4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00711:Golga4	APN	9	118514271	critical splice donor site	probably null
IGL00801:Golga4	APN	9	118538926	missense	probably damaging	0.98
IGL01395:Golga4	APN	9	118535373	missense	probably damaging	1.00
IGL01472:Golga4	APN	9	118532574	missense	probably damaging	1.00
IGL01519:Golga4	APN	9	118527092	missense	probably damaging	1.00
IGL01563:Golga4	APN	9	118527006	splice site	probably benign
IGL02593:Golga4	APN	9	118555566	unclassified	probably benign
IGL02803:Golga4	APN	9	118535460	missense	probably benign
IGL02939:Golga4	APN	9	118535454	missense	probably benign	0.01
IGL02939:Golga4	APN	9	118534632	missense	probably damaging	1.00
IGL03123:Golga4	APN	9	118536885	missense	probably damaging	1.00
IGL03334:Golga4	APN	9	118537233	splice site	probably benign
F5770:Golga4	UTSW	9	118556075	missense	possibly damaging	0.62
F6893:Golga4	UTSW	9	118553457	missense	probably damaging	1.00
R0179:Golga4	UTSW	9	118560740	critical splice acceptor site	probably null
R0279:Golga4	UTSW	9	118568993	missense	probably benign	0.00
R0362:Golga4	UTSW	9	118555785	missense	probably benign	0.13
R0973:Golga4	UTSW	9	118537273	missense	probably damaging	1.00
R0973:Golga4	UTSW	9	118537273	missense	probably damaging	1.00
R0974:Golga4	UTSW	9	118537273	missense	probably damaging	1.00
R1128:Golga4	UTSW	9	118548784	missense	probably benign	0.40
R1384:Golga4	UTSW	9	118565651	missense	probably damaging	0.99
R1435:Golga4	UTSW	9	118535440	missense	probably benign	0.00
R1513:Golga4	UTSW	9	118555732	missense	probably benign	0.02
R1818:Golga4	UTSW	9	118572987	missense	probably damaging	1.00
R2083:Golga4	UTSW	9	118532590	missense	probably damaging	1.00
R2243:Golga4	UTSW	9	118556904	missense	probably benign	0.06
R2355:Golga4	UTSW	9	118560742	missense	probably benign	0.00
R2518:Golga4	UTSW	9	118556612	missense	probably damaging	1.00
R2921:Golga4	UTSW	9	118559343	missense	possibly damaging	0.49
R2922:Golga4	UTSW	9	118559343	missense	possibly damaging	0.49
R2923:Golga4	UTSW	9	118559343	missense	possibly damaging	0.49
R3121:Golga4	UTSW	9	118557380	missense	possibly damaging	0.68
R3424:Golga4	UTSW	9	118534647	missense	probably benign	0.16
R3909:Golga4	UTSW	9	118558736	missense	possibly damaging	0.82
R3913:Golga4	UTSW	9	118538971	missense	probably damaging	0.99
R4321:Golga4	UTSW	9	118556435	missense	probably damaging	1.00
R4358:Golga4	UTSW	9	118551878	missense	probably benign	0.16
R4483:Golga4	UTSW	9	118514186	missense	probably damaging	1.00
R4515:Golga4	UTSW	9	118559008	missense	probably benign	0.28
R4518:Golga4	UTSW	9	118559008	missense	probably benign	0.28
R4519:Golga4	UTSW	9	118559008	missense	probably benign	0.28
R4545:Golga4	UTSW	9	118556845	missense	probably damaging	1.00
R4546:Golga4	UTSW	9	118556845	missense	probably damaging	1.00
R4580:Golga4	UTSW	9	118557259	missense	probably benign	0.00
R4918:Golga4	UTSW	9	118558145	missense	probably damaging	1.00
R5007:Golga4	UTSW	9	118558300	missense	probably benign
R5045:Golga4	UTSW	9	118565656	missense	probably benign
R5232:Golga4	UTSW	9	118506558	critical splice donor site	probably null
R5256:Golga4	UTSW	9	118556501	missense	possibly damaging	0.93
R5502:Golga4	UTSW	9	118559057	nonsense	probably null
R5567:Golga4	UTSW	9	118558183	missense	probably damaging	1.00
R5576:Golga4	UTSW	9	118553534	missense	probably benign	0.13
R5771:Golga4	UTSW	9	118558283	missense	probably damaging	0.96
R5807:Golga4	UTSW	9	118527130	missense	probably damaging	0.99
R5860:Golga4	UTSW	9	118558106	missense	probably damaging	1.00
R6012:Golga4	UTSW	9	118559696	missense	possibly damaging	0.90
R6285:Golga4	UTSW	9	118558627	nonsense	probably null
R6299:Golga4	UTSW	9	118557370	missense	probably benign	0.03
R6467:Golga4	UTSW	9	118536792	missense	probably damaging	1.00
R6552:Golga4	UTSW	9	118514231	missense	probably damaging	1.00
R6688:Golga4	UTSW	9	118514210	missense	possibly damaging	0.66
R6965:Golga4	UTSW	9	118548779	missense	probably damaging	1.00
R6987:Golga4	UTSW	9	118558532	missense	probably benign
R7212:Golga4	UTSW	9	118536840	missense	possibly damaging	0.80
R7426:Golga4	UTSW	9	118559495	missense	probably benign
R7431:Golga4	UTSW	9	118559731	missense	probably damaging	1.00
R7641:Golga4	UTSW	9	118557575	missense	probably benign	0.05
R7727:Golga4	UTSW	9	118548702	missense	probably damaging	1.00
R7729:Golga4	UTSW	9	118556063	missense	possibly damaging	0.51
R7811:Golga4	UTSW	9	118532575	missense	probably damaging	1.00
R7849:Golga4	UTSW	9	118559311	missense	possibly damaging	0.93
R7891:Golga4	UTSW	9	118556366	missense	probably damaging	1.00
R7976:Golga4	UTSW	9	118536768	missense	possibly damaging	0.49
R8275:Golga4	UTSW	9	118532559	missense	probably damaging	1.00
R8378:Golga4	UTSW	9	118558322	missense	probably benign	0.03
R8514:Golga4	UTSW	9	118555796	missense	possibly damaging	0.47
RF022:Golga4	UTSW	9	118557989	missense	probably damaging	1.00
V7583:Golga4	UTSW	9	118556075	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- GCAACAGTATACAGAAACATGCCT -3'
(R):5'- CTCTGGAGCCCACACAGC -3'

Sequencing Primer
(F):5'- GTTAAAAGTGCTTGTAACCTTTGCC -3'
(R):5'- CTCTCTGTAAGGATGGCT -3'

Posted On

2019-06-07