Incidental Mutation 'PIT4382001:Golga4'
ID 554694
Institutional Source Beutler Lab
Gene Symbol Golga4
Ensembl Gene ENSMUSG00000038708
Gene Name golgin A4
Synonyms golgin-245, Olp-1
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # PIT4382001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 118335335-118411587 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 118382521 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 542 (Y542N)
Ref Sequence ENSEMBL: ENSMUSP00000081880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084820] [ENSMUST00000212097] [ENSMUST00000212461]
AlphaFold Q91VW5
Predicted Effect possibly damaging
Transcript: ENSMUST00000084820
AA Change: Y542N

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000081880
Gene: ENSMUSG00000038708
AA Change: Y542N

DomainStartEndE-ValueType
low complexity region 10 41 N/A INTRINSIC
coiled coil region 157 241 N/A INTRINSIC
internal_repeat_1 271 299 2.93e-5 PROSPERO
low complexity region 339 351 N/A INTRINSIC
low complexity region 513 532 N/A INTRINSIC
low complexity region 547 566 N/A INTRINSIC
low complexity region 705 715 N/A INTRINSIC
low complexity region 739 755 N/A INTRINSIC
low complexity region 882 895 N/A INTRINSIC
SCOP:d1epua_ 940 1076 2e-3 SMART
low complexity region 1138 1152 N/A INTRINSIC
low complexity region 1161 1182 N/A INTRINSIC
low complexity region 1204 1228 N/A INTRINSIC
coiled coil region 1283 1496 N/A INTRINSIC
internal_repeat_2 1500 1525 5.98e-5 PROSPERO
coiled coil region 1541 1715 N/A INTRINSIC
low complexity region 1756 1778 N/A INTRINSIC
internal_repeat_1 1811 1839 2.93e-5 PROSPERO
coiled coil region 1844 1883 N/A INTRINSIC
internal_repeat_2 1899 1924 5.98e-5 PROSPERO
coiled coil region 1933 2160 N/A INTRINSIC
Grip 2181 2225 1.38e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211840
Predicted Effect possibly damaging
Transcript: ENSMUST00000212097
AA Change: Y514N

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000212183
Predicted Effect probably benign
Transcript: ENSMUST00000212461
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.5%
  • 10x: 84.6%
  • 20x: 72.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This protein has been postulated to play a role in Rab6-regulated membrane-tethering events in the Golgi apparatus. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]
Allele List at MGI

All alleles(32) : Gene trapped(32)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430038I01Rik G T 7: 136,978,711 (GRCm39) H144N unknown Het
Acsm4 C T 7: 119,297,798 (GRCm39) T145M probably damaging Het
Adam10 T C 9: 70,673,363 (GRCm39) L498P probably damaging Het
Adgrl2 A G 3: 148,522,934 (GRCm39) L430P Het
Alk T C 17: 72,256,916 (GRCm39) M648V probably benign Het
Arhgap35 T C 7: 16,297,794 (GRCm39) R424G possibly damaging Het
Baiap2l1 T C 5: 144,215,480 (GRCm39) K342E possibly damaging Het
Ccdc54 C T 16: 50,411,219 (GRCm39) V16M probably damaging Het
Chil3 T G 3: 106,055,975 (GRCm39) D366A probably damaging Het
Chuk A G 19: 44,087,046 (GRCm39) V151A probably damaging Het
Cpd T G 11: 76,688,614 (GRCm39) H886P probably benign Het
Cped1 T A 6: 22,222,449 (GRCm39) C736* probably null Het
Creb3l3 T C 10: 80,920,746 (GRCm39) E428G probably benign Het
Csad G A 15: 102,097,085 (GRCm39) L7F probably benign Het
Dnah1 C T 14: 31,006,412 (GRCm39) D2255N probably damaging Het
Dnajb12 T C 10: 59,728,508 (GRCm39) Y159H probably damaging Het
Dpysl4 T A 7: 138,669,494 (GRCm39) Y57* probably null Het
F2rl1 T G 13: 95,650,154 (GRCm39) N243H probably benign Het
Fhl4 T C 10: 84,934,293 (GRCm39) K163E possibly damaging Het
Flot2 T C 11: 77,944,193 (GRCm39) S46P possibly damaging Het
Fsip2 C A 2: 82,821,196 (GRCm39) T5643K possibly damaging Het
Il17re A G 6: 113,446,038 (GRCm39) T426A probably benign Het
Kdm2a T A 19: 4,393,201 (GRCm39) M385L probably benign Het
Kdm3b T C 18: 34,942,140 (GRCm39) S744P probably damaging Het
Krtap20-1 T A 16: 88,881,048 (GRCm39) Y26* probably null Het
Lama2 T C 10: 27,080,901 (GRCm39) D974G probably damaging Het
Ldc1 A T 4: 130,112,954 (GRCm39) N147K possibly damaging Het
Lipo5 A T 19: 33,443,339 (GRCm39) L159Q probably null Het
LTO1 T A 7: 144,470,181 (GRCm39) Y37N probably damaging Het
Mau2 C T 8: 70,483,302 (GRCm39) E187K possibly damaging Het
Mrpl9 T C 3: 94,355,136 (GRCm39) L236P probably benign Het
Mta1 A G 12: 113,096,870 (GRCm39) T564A probably benign Het
Mylk C T 16: 34,696,012 (GRCm39) S249L probably damaging Het
Ncor1 G T 11: 62,235,489 (GRCm39) T331K probably damaging Het
Nsun3 T A 16: 62,606,228 (GRCm39) K15N probably damaging Het
Nsun5 A G 5: 135,400,355 (GRCm39) Y132C probably benign Het
Obsl1 T A 1: 75,464,607 (GRCm39) T1605S probably benign Het
Or10a3n A G 7: 108,493,309 (GRCm39) Y107H probably damaging Het
Or51f1 A G 7: 102,505,809 (GRCm39) Y227H probably damaging Het
Or51t4 A T 7: 102,598,656 (GRCm39) Y328F probably benign Het
Or5b109 T C 19: 13,212,259 (GRCm39) I215T probably damaging Het
P2rx1 A G 11: 72,900,026 (GRCm39) N148D probably benign Het
Pogz T A 3: 94,787,107 (GRCm39) S1232T probably damaging Het
Polr3b C A 10: 84,520,049 (GRCm39) T655N probably damaging Het
Prss34 T C 17: 25,517,882 (GRCm39) probably null Het
Rhpn2 A G 7: 35,090,178 (GRCm39) probably null Het
Runx1 T A 16: 92,410,648 (GRCm39) D256V probably damaging Het
Shc1 C A 3: 89,334,715 (GRCm39) Q525K probably benign Het
Slc10a5 T C 3: 10,400,507 (GRCm39) D51G probably benign Het
Slc6a3 A T 13: 73,719,642 (GRCm39) N557I probably benign Het
Slmap C T 14: 26,254,586 (GRCm39) R32H probably damaging Het
Spata31d1c T C 13: 65,183,985 (GRCm39) I509T probably benign Het
Spata31e4 A T 13: 50,855,007 (GRCm39) E215V probably damaging Het
Srr C A 11: 74,801,134 (GRCm39) V138F probably benign Het
Tas2r118 G A 6: 23,969,785 (GRCm39) T92I possibly damaging Het
Tcaf2 A T 6: 42,601,300 (GRCm39) *920K probably null Het
Tenm2 T A 11: 35,954,729 (GRCm39) Y1141F probably damaging Het
Thoc6 T C 17: 23,887,841 (GRCm39) N322S probably benign Het
Tlcd2 A G 11: 75,359,417 (GRCm39) I70V probably benign Het
Tmem214 A G 5: 31,028,795 (GRCm39) D128G possibly damaging Het
Trav13d-4 T C 14: 53,995,238 (GRCm39) V64A probably benign Het
Tyro3 T C 2: 119,632,845 (GRCm39) W122R probably damaging Het
Ugcg A G 4: 59,213,246 (GRCm39) D144G possibly damaging Het
Uimc1 T C 13: 55,178,828 (GRCm39) D627G probably benign Het
Utp6 T C 11: 79,853,099 (GRCm39) I13V probably benign Het
Vmn2r99 A G 17: 19,614,605 (GRCm39) K775R probably damaging Het
Wdfy3 CG C 5: 102,030,827 (GRCm39) probably null Het
Zw10 C T 9: 48,982,944 (GRCm39) T525I probably benign Het
Other mutations in Golga4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00711:Golga4 APN 9 118,343,339 (GRCm39) critical splice donor site probably null
IGL00801:Golga4 APN 9 118,367,994 (GRCm39) missense probably damaging 0.98
IGL01395:Golga4 APN 9 118,364,441 (GRCm39) missense probably damaging 1.00
IGL01472:Golga4 APN 9 118,361,642 (GRCm39) missense probably damaging 1.00
IGL01519:Golga4 APN 9 118,356,160 (GRCm39) missense probably damaging 1.00
IGL01563:Golga4 APN 9 118,356,074 (GRCm39) splice site probably benign
IGL02593:Golga4 APN 9 118,384,634 (GRCm39) unclassified probably benign
IGL02803:Golga4 APN 9 118,364,528 (GRCm39) missense probably benign
IGL02939:Golga4 APN 9 118,363,700 (GRCm39) missense probably damaging 1.00
IGL02939:Golga4 APN 9 118,364,522 (GRCm39) missense probably benign 0.01
IGL03123:Golga4 APN 9 118,365,953 (GRCm39) missense probably damaging 1.00
IGL03334:Golga4 APN 9 118,366,301 (GRCm39) splice site probably benign
F5770:Golga4 UTSW 9 118,385,143 (GRCm39) missense possibly damaging 0.62
F6893:Golga4 UTSW 9 118,382,525 (GRCm39) missense probably damaging 1.00
R0179:Golga4 UTSW 9 118,389,808 (GRCm39) critical splice acceptor site probably null
R0279:Golga4 UTSW 9 118,398,061 (GRCm39) missense probably benign 0.00
R0362:Golga4 UTSW 9 118,384,853 (GRCm39) missense probably benign 0.13
R0973:Golga4 UTSW 9 118,366,341 (GRCm39) missense probably damaging 1.00
R0973:Golga4 UTSW 9 118,366,341 (GRCm39) missense probably damaging 1.00
R0974:Golga4 UTSW 9 118,366,341 (GRCm39) missense probably damaging 1.00
R1128:Golga4 UTSW 9 118,377,852 (GRCm39) missense probably benign 0.40
R1384:Golga4 UTSW 9 118,394,719 (GRCm39) missense probably damaging 0.99
R1435:Golga4 UTSW 9 118,364,508 (GRCm39) missense probably benign 0.00
R1513:Golga4 UTSW 9 118,384,800 (GRCm39) missense probably benign 0.02
R1818:Golga4 UTSW 9 118,402,055 (GRCm39) missense probably damaging 1.00
R2083:Golga4 UTSW 9 118,361,658 (GRCm39) missense probably damaging 1.00
R2243:Golga4 UTSW 9 118,385,972 (GRCm39) missense probably benign 0.06
R2355:Golga4 UTSW 9 118,389,810 (GRCm39) missense probably benign 0.00
R2518:Golga4 UTSW 9 118,385,680 (GRCm39) missense probably damaging 1.00
R2921:Golga4 UTSW 9 118,388,411 (GRCm39) missense possibly damaging 0.49
R2922:Golga4 UTSW 9 118,388,411 (GRCm39) missense possibly damaging 0.49
R2923:Golga4 UTSW 9 118,388,411 (GRCm39) missense possibly damaging 0.49
R3121:Golga4 UTSW 9 118,386,448 (GRCm39) missense possibly damaging 0.68
R3424:Golga4 UTSW 9 118,363,715 (GRCm39) missense probably benign 0.16
R3909:Golga4 UTSW 9 118,387,804 (GRCm39) missense possibly damaging 0.82
R3913:Golga4 UTSW 9 118,368,039 (GRCm39) missense probably damaging 0.99
R4321:Golga4 UTSW 9 118,385,503 (GRCm39) missense probably damaging 1.00
R4358:Golga4 UTSW 9 118,380,946 (GRCm39) missense probably benign 0.16
R4483:Golga4 UTSW 9 118,343,254 (GRCm39) missense probably damaging 1.00
R4515:Golga4 UTSW 9 118,388,076 (GRCm39) missense probably benign 0.28
R4518:Golga4 UTSW 9 118,388,076 (GRCm39) missense probably benign 0.28
R4519:Golga4 UTSW 9 118,388,076 (GRCm39) missense probably benign 0.28
R4545:Golga4 UTSW 9 118,385,913 (GRCm39) missense probably damaging 1.00
R4546:Golga4 UTSW 9 118,385,913 (GRCm39) missense probably damaging 1.00
R4580:Golga4 UTSW 9 118,386,327 (GRCm39) missense probably benign 0.00
R4918:Golga4 UTSW 9 118,387,213 (GRCm39) missense probably damaging 1.00
R5007:Golga4 UTSW 9 118,387,368 (GRCm39) missense probably benign
R5045:Golga4 UTSW 9 118,394,724 (GRCm39) missense probably benign
R5232:Golga4 UTSW 9 118,335,626 (GRCm39) critical splice donor site probably null
R5256:Golga4 UTSW 9 118,385,569 (GRCm39) missense possibly damaging 0.93
R5502:Golga4 UTSW 9 118,388,125 (GRCm39) nonsense probably null
R5567:Golga4 UTSW 9 118,387,251 (GRCm39) missense probably damaging 1.00
R5576:Golga4 UTSW 9 118,382,602 (GRCm39) missense probably benign 0.13
R5771:Golga4 UTSW 9 118,387,351 (GRCm39) missense probably damaging 0.96
R5807:Golga4 UTSW 9 118,356,198 (GRCm39) missense probably damaging 0.99
R5860:Golga4 UTSW 9 118,387,174 (GRCm39) missense probably damaging 1.00
R6012:Golga4 UTSW 9 118,388,764 (GRCm39) missense possibly damaging 0.90
R6285:Golga4 UTSW 9 118,387,695 (GRCm39) nonsense probably null
R6299:Golga4 UTSW 9 118,386,438 (GRCm39) missense probably benign 0.03
R6467:Golga4 UTSW 9 118,365,860 (GRCm39) missense probably damaging 1.00
R6552:Golga4 UTSW 9 118,343,299 (GRCm39) missense probably damaging 1.00
R6688:Golga4 UTSW 9 118,343,278 (GRCm39) missense possibly damaging 0.66
R6965:Golga4 UTSW 9 118,377,847 (GRCm39) missense probably damaging 1.00
R6987:Golga4 UTSW 9 118,387,600 (GRCm39) missense probably benign
R7212:Golga4 UTSW 9 118,365,908 (GRCm39) missense possibly damaging 0.80
R7426:Golga4 UTSW 9 118,388,563 (GRCm39) missense probably benign
R7431:Golga4 UTSW 9 118,388,799 (GRCm39) missense probably damaging 1.00
R7641:Golga4 UTSW 9 118,386,643 (GRCm39) missense probably benign 0.05
R7727:Golga4 UTSW 9 118,377,770 (GRCm39) missense probably damaging 1.00
R7729:Golga4 UTSW 9 118,385,131 (GRCm39) missense possibly damaging 0.51
R7811:Golga4 UTSW 9 118,361,643 (GRCm39) missense probably damaging 1.00
R7849:Golga4 UTSW 9 118,388,379 (GRCm39) missense possibly damaging 0.93
R7891:Golga4 UTSW 9 118,385,434 (GRCm39) missense probably damaging 1.00
R7976:Golga4 UTSW 9 118,365,836 (GRCm39) missense possibly damaging 0.49
R8275:Golga4 UTSW 9 118,361,627 (GRCm39) missense probably damaging 1.00
R8378:Golga4 UTSW 9 118,387,390 (GRCm39) missense probably benign 0.03
R8514:Golga4 UTSW 9 118,384,864 (GRCm39) missense possibly damaging 0.47
R8698:Golga4 UTSW 9 118,385,029 (GRCm39) missense probably damaging 0.97
R8856:Golga4 UTSW 9 118,385,779 (GRCm39) missense probably damaging 0.98
R9227:Golga4 UTSW 9 118,385,941 (GRCm39) missense possibly damaging 0.94
R9282:Golga4 UTSW 9 118,385,893 (GRCm39) missense probably damaging 1.00
RF022:Golga4 UTSW 9 118,387,057 (GRCm39) missense probably damaging 1.00
V7583:Golga4 UTSW 9 118,385,143 (GRCm39) missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GCAACAGTATACAGAAACATGCCT -3'
(R):5'- CTCTGGAGCCCACACAGC -3'

Sequencing Primer
(F):5'- GTTAAAAGTGCTTGTAACCTTTGCC -3'
(R):5'- CTCTCTGTAAGGATGGCT -3'
Posted On 2019-06-07