Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4382001:Slc6a3'

554712

Institutional Source

Beutler Lab

Gene Symbol

Slc6a3

Ensembl Gene

ENSMUSG00000021609

Gene Name

solute carrier family 6 (neurotransmitter transporter, dopamine), member 3

Synonyms

Dat1, DAT

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

PIT4382001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

73536747-73578672 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 73571523 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 557 (N557I)

Ref Sequence

ENSEMBL: ENSMUSP00000022100 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022100]

AlphaFold

Q61327

Predicted Effect

probably benign
Transcript: ENSMUST00000022100
AA Change: N557I

PolyPhen 2 Score 0.348 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000022100
Gene: ENSMUSG00000021609
AA Change: N557I

Domain	Start	End	E-Value	Type
Pfam:SNF	60	582	8.1e-237	PFAM

Coding Region Coverage

1x: 92.9%
3x: 90.5%
10x: 84.6%
20x: 72.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dopamine transporter which is a member of the sodium- and chloride-dependent neurotransmitter transporter family. The 3' UTR of this gene contains a 40 bp tandem repeat, referred to as a variable number tandem repeat or VNTR, which can be present in 3 to 11 copies. Variation in the number of repeats is associated with idiopathic epilepsy, attention-deficit hyperactivity disorder, dependence on alcohol and cocaine, susceptibility to Parkinson disease and protection against nicotine dependence.[provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit dwarfism, hyperactivity (especially in a novel environment), 5-fold higher extracellular dopamine levels, impaired spatial cognitive function, anterior pituitary hypoplasia, and failure to lactate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9430038I01Rik	G	T	7: 137,376,982	H144N	unknown	Het
Acsm4	C	T	7: 119,698,575	T145M	probably damaging	Het
Adam10	T	C	9: 70,766,081	L498P	probably damaging	Het
Adgrl2	A	G	3: 148,817,298	L430P		Het
Alk	T	C	17: 71,949,921	M648V	probably benign	Het
Arhgap35	T	C	7: 16,563,869	R424G	possibly damaging	Het
Baiap2l1	T	C	5: 144,278,670	K342E	possibly damaging	Het
Ccdc54	C	T	16: 50,590,856	V16M	probably damaging	Het
Chil3	T	G	3: 106,148,659	D366A	probably damaging	Het
Chuk	A	G	19: 44,098,607	V151A	probably damaging	Het
Cpd	T	G	11: 76,797,788	H886P	probably benign	Het
Cped1	T	A	6: 22,222,450	C736*	probably null	Het
Creb3l3	T	C	10: 81,084,912	E428G	probably benign	Het
Csad	G	A	15: 102,188,650	L7F	probably benign	Het
Dnah1	C	T	14: 31,284,455	D2255N	probably damaging	Het
Dnajb12	T	C	10: 59,892,686	Y159H	probably damaging	Het
Dpysl4	T	A	7: 139,089,578	Y57*	probably null	Het
F2rl1	T	G	13: 95,513,646	N243H	probably benign	Het
Fhl4	T	C	10: 85,098,429	K163E	possibly damaging	Het
Flot2	T	C	11: 78,053,367	S46P	possibly damaging	Het
Fsip2	C	A	2: 82,990,852	T5643K	possibly damaging	Het
Gm853	A	T	4: 130,219,161	N147K	possibly damaging	Het
Gm8765	A	T	13: 50,700,971	E215V	probably damaging	Het
Golga4	T	A	9: 118,553,453	Y542N	possibly damaging	Het
Il17re	A	G	6: 113,469,077	T426A	probably benign	Het
Kdm2a	T	A	19: 4,343,173	M385L	probably benign	Het
Kdm3b	T	C	18: 34,809,087	S744P	probably damaging	Het
Krtap6-3	T	A	16: 89,084,160	Y26*	probably null	Het
Lama2	T	C	10: 27,204,905	D974G	probably damaging	Het
Lipo5	A	T	19: 33,465,939	L159Q	probably null	Het
Mau2	C	T	8: 70,030,652	E187K	possibly damaging	Het
Mrpl9	T	C	3: 94,447,829	L236P	probably benign	Het
Mta1	A	G	12: 113,133,250	T564A	probably benign	Het
Mylk	C	T	16: 34,875,642	S249L	probably damaging	Het
Ncor1	G	T	11: 62,344,663	T331K	probably damaging	Het
Nsun3	T	A	16: 62,785,865	K15N	probably damaging	Het
Nsun5	A	G	5: 135,371,501	Y132C	probably benign	Het
Obsl1	T	A	1: 75,487,963	T1605S	probably benign	Het
Olfr1463	T	C	19: 13,234,895	I215T	probably damaging	Het
Olfr519	A	G	7: 108,894,102	Y107H	probably damaging	Het
Olfr566	A	G	7: 102,856,602	Y227H	probably damaging	Het
Olfr574	A	T	7: 102,949,449	Y328F	probably benign	Het
Oraov1	T	A	7: 144,916,444	Y37N	probably damaging	Het
P2rx1	A	G	11: 73,009,200	N148D	probably benign	Het
Pogz	T	A	3: 94,879,796	S1232T	probably damaging	Het
Polr3b	C	A	10: 84,684,185	T655N	probably damaging	Het
Prss34	T	C	17: 25,298,908		probably null	Het
Rhpn2	A	G	7: 35,390,753		probably null	Het
Runx1	T	A	16: 92,613,760	D256V	probably damaging	Het
Shc1	C	A	3: 89,427,408	Q525K	probably benign	Het
Slc10a5	T	C	3: 10,335,447	D51G	probably benign	Het
Slmap	C	T	14: 26,533,431	R32H	probably damaging	Het
Spata31d1c	T	C	13: 65,036,171	I509T	probably benign	Het
Srr	C	A	11: 74,910,308	V138F	probably benign	Het
Tas2r118	G	A	6: 23,969,786	T92I	possibly damaging	Het
Tcaf2	A	T	6: 42,624,366	*920K	probably null	Het
Tenm2	T	A	11: 36,063,902	Y1141F	probably damaging	Het
Thoc6	T	C	17: 23,668,867	N322S	probably benign	Het
Tlcd2	A	G	11: 75,468,591	I70V	probably benign	Het
Tmem214	A	G	5: 30,871,451	D128G	possibly damaging	Het
Trav13-4-dv7	T	C	14: 53,757,781	V64A	probably benign	Het
Tyro3	T	C	2: 119,802,364	W122R	probably damaging	Het
Ugcg	A	G	4: 59,213,246	D144G	possibly damaging	Het
Uimc1	T	C	13: 55,031,015	D627G	probably benign	Het
Utp6	T	C	11: 79,962,273	I13V	probably benign	Het
Vmn2r99	A	G	17: 19,394,343	K775R	probably damaging	Het
Wdfy3	CG	C	5: 101,882,961		probably null	Het
Zw10	C	T	9: 49,071,644	T525I	probably benign	Het

Other mutations in Slc6a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00773:Slc6a3	APN	13	73544741	missense	probably damaging	1.00
IGL01524:Slc6a3	APN	13	73538549	missense	probably benign	0.01
IGL02015:Slc6a3	APN	13	73544714	missense	possibly damaging	0.60
IGL03008:Slc6a3	APN	13	73558285	critical splice donor site	probably null
IGL03029:Slc6a3	APN	13	73538697	missense	probably damaging	1.00
IGL03064:Slc6a3	APN	13	73571466	missense	probably damaging	0.99
IGL03272:Slc6a3	APN	13	73540929	missense	probably damaging	0.98
IGL03294:Slc6a3	APN	13	73557181	critical splice donor site	probably null
IGL03345:Slc6a3	APN	13	73571514	missense	probably benign
IGL03410:Slc6a3	APN	13	73538657	missense	probably benign	0.03
disney	UTSW	13	73544884	missense	probably benign
dopey	UTSW	13	73560959	missense	probably damaging	1.00
Dopey2	UTSW	13	73544817	missense	probably damaging	1.00
Stiff	UTSW	13	73557050	missense	possibly damaging	0.85
R0024:Slc6a3	UTSW	13	73540837	splice site	probably benign
R0125:Slc6a3	UTSW	13	73569979	splice site	probably benign
R0180:Slc6a3	UTSW	13	73562336	missense	probably damaging	1.00
R0288:Slc6a3	UTSW	13	73560928	missense	probably damaging	1.00
R0322:Slc6a3	UTSW	13	73560926	missense	possibly damaging	0.61
R0349:Slc6a3	UTSW	13	73567557	missense	probably damaging	1.00
R0411:Slc6a3	UTSW	13	73557050	missense	possibly damaging	0.85
R0594:Slc6a3	UTSW	13	73538642	missense	probably damaging	0.99
R0680:Slc6a3	UTSW	13	73538727	missense	probably damaging	1.00
R1099:Slc6a3	UTSW	13	73567641	missense	probably benign	0.21
R1109:Slc6a3	UTSW	13	73557080	missense	probably benign	0.00
R1791:Slc6a3	UTSW	13	73566292	missense	possibly damaging	0.82
R3916:Slc6a3	UTSW	13	73562308	missense	probably benign	0.00
R4279:Slc6a3	UTSW	13	73544834	missense	possibly damaging	0.90
R4368:Slc6a3	UTSW	13	73560912	nonsense	probably null
R4520:Slc6a3	UTSW	13	73540856	missense	possibly damaging	0.95
R4666:Slc6a3	UTSW	13	73538581	missense	possibly damaging	0.47
R4675:Slc6a3	UTSW	13	73544817	missense	probably damaging	1.00
R4716:Slc6a3	UTSW	13	73557076	missense	probably benign	0.04
R5243:Slc6a3	UTSW	13	73571451	missense	possibly damaging	0.61
R5355:Slc6a3	UTSW	13	73560959	missense	probably damaging	1.00
R5681:Slc6a3	UTSW	13	73538735	missense	probably damaging	0.99
R5737:Slc6a3	UTSW	13	73544804	missense	probably damaging	0.99
R6142:Slc6a3	UTSW	13	73544783	missense	probably benign	0.00
R6471:Slc6a3	UTSW	13	73544884	missense	probably benign
R7168:Slc6a3	UTSW	13	73571472	missense	probably benign	0.00
R7403:Slc6a3	UTSW	13	73562427	critical splice donor site	probably null
R8282:Slc6a3	UTSW	13	73557081	missense	probably benign	0.01
R8359:Slc6a3	UTSW	13	73544883	missense	probably benign
R8446:Slc6a3	UTSW	13	73571555	missense	possibly damaging	0.67
R8979:Slc6a3	UTSW	13	73567601	missense	probably benign	0.20
R9051:Slc6a3	UTSW	13	73569912	nonsense	probably null
R9377:Slc6a3	UTSW	13	73544847	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- GCACTTGTGTTGTTAGGAGACC -3'
(R):5'- TGGCATACACATATGTACCCC -3'

Sequencing Primer
(F):5'- GGAGACCTTCTGTAAAAAGCTTGCTG -3'
(R):5'- ATTGAATCATCCCATTATCCCAGC -3'

Posted On

2019-06-07