Incidental Mutation 'PIT4382001:Dnah1'
ID554715
Institutional Source Beutler Lab
Gene Symbol Dnah1
Ensembl Gene ENSMUSG00000019027
Gene Namedynein, axonemal, heavy chain 1
SynonymsE030034C22Rik, MDHC7, Dnahc1, B230373P09Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4382001 (G1)
Quality Score165.009
Status Not validated
Chromosome14
Chromosomal Location31260375-31323896 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 31284455 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 2255 (D2255N)
Ref Sequence ENSEMBL: ENSMUSP00000043281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048603]
Predicted Effect probably damaging
Transcript: ENSMUST00000048603
AA Change: D2255N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043281
Gene: ENSMUSG00000019027
AA Change: D2255N

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DHC_N2 998 1404 6.3e-146 PFAM
AAA 1558 1697 6.02e-1 SMART
AAA 1839 2077 4.66e0 SMART
low complexity region 2149 2157 N/A INTRINSIC
AAA 2204 2353 2.35e-1 SMART
Pfam:AAA_8 2533 2803 7.7e-84 PFAM
Pfam:MT 2815 3165 9.9e-57 PFAM
Pfam:AAA_9 3185 3410 1.1e-93 PFAM
Pfam:Dynein_heavy 3545 4246 2.7e-275 PFAM
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.5%
  • 10x: 84.6%
  • 20x: 72.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an inner dynein arm heavy chain that provides structural support between the radial spokes and the outer doublet of the sperm tail. Naturally occurring mutations in this gene are associated with primary ciliary dyskinesia and multiple morphological anomalies of the flagella that result in asthenozoospermia and male infertility. Mice with a homozygous knockout of the orthologous gene are viable but have reduced sperm motility and are infertile. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous mutants are male sterile, and show impaired ciliary and flagellar motility that is also observed in the tracheal cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430038I01Rik G T 7: 137,376,982 H144N unknown Het
Acsm4 C T 7: 119,698,575 T145M probably damaging Het
Adam10 T C 9: 70,766,081 L498P probably damaging Het
Adgrl2 A G 3: 148,817,298 L430P Het
Alk T C 17: 71,949,921 M648V probably benign Het
Arhgap35 T C 7: 16,563,869 R424G possibly damaging Het
Baiap2l1 T C 5: 144,278,670 K342E possibly damaging Het
Ccdc54 C T 16: 50,590,856 V16M probably damaging Het
Chil3 T G 3: 106,148,659 D366A probably damaging Het
Chuk A G 19: 44,098,607 V151A probably damaging Het
Cpd T G 11: 76,797,788 H886P probably benign Het
Cped1 T A 6: 22,222,450 C736* probably null Het
Creb3l3 T C 10: 81,084,912 E428G probably benign Het
Csad G A 15: 102,188,650 L7F probably benign Het
Dnajb12 T C 10: 59,892,686 Y159H probably damaging Het
Dpysl4 T A 7: 139,089,578 Y57* probably null Het
F2rl1 T G 13: 95,513,646 N243H probably benign Het
Fhl4 T C 10: 85,098,429 K163E possibly damaging Het
Flot2 T C 11: 78,053,367 S46P possibly damaging Het
Fsip2 C A 2: 82,990,852 T5643K possibly damaging Het
Gm853 A T 4: 130,219,161 N147K possibly damaging Het
Gm8765 A T 13: 50,700,971 E215V probably damaging Het
Golga4 T A 9: 118,553,453 Y542N possibly damaging Het
Il17re A G 6: 113,469,077 T426A probably benign Het
Kdm2a T A 19: 4,343,173 M385L probably benign Het
Kdm3b T C 18: 34,809,087 S744P probably damaging Het
Krtap6-3 T A 16: 89,084,160 Y26* probably null Het
Lama2 T C 10: 27,204,905 D974G probably damaging Het
Lipo5 A T 19: 33,465,939 L159Q probably null Het
Mau2 C T 8: 70,030,652 E187K possibly damaging Het
Mrpl9 T C 3: 94,447,829 L236P probably benign Het
Mta1 A G 12: 113,133,250 T564A probably benign Het
Mylk C T 16: 34,875,642 S249L probably damaging Het
Ncor1 G T 11: 62,344,663 T331K probably damaging Het
Nsun3 T A 16: 62,785,865 K15N probably damaging Het
Nsun5 A G 5: 135,371,501 Y132C probably benign Het
Obsl1 T A 1: 75,487,963 T1605S probably benign Het
Olfr1463 T C 19: 13,234,895 I215T probably damaging Het
Olfr519 A G 7: 108,894,102 Y107H probably damaging Het
Olfr566 A G 7: 102,856,602 Y227H probably damaging Het
Olfr574 A T 7: 102,949,449 Y328F probably benign Het
Oraov1 T A 7: 144,916,444 Y37N probably damaging Het
P2rx1 A G 11: 73,009,200 N148D probably benign Het
Pogz T A 3: 94,879,796 S1232T probably damaging Het
Polr3b C A 10: 84,684,185 T655N probably damaging Het
Prss34 T C 17: 25,298,908 probably null Het
Rhpn2 A G 7: 35,390,753 probably null Het
Runx1 T A 16: 92,613,760 D256V probably damaging Het
Shc1 C A 3: 89,427,408 Q525K probably benign Het
Slc10a5 T C 3: 10,335,447 D51G probably benign Het
Slc6a3 A T 13: 73,571,523 N557I probably benign Het
Slmap C T 14: 26,533,431 R32H probably damaging Het
Spata31d1c T C 13: 65,036,171 I509T probably benign Het
Srr C A 11: 74,910,308 V138F probably benign Het
Tas2r118 G A 6: 23,969,786 T92I possibly damaging Het
Tcaf2 A T 6: 42,624,366 *920K probably null Het
Tenm2 T A 11: 36,063,902 Y1141F probably damaging Het
Thoc6 T C 17: 23,668,867 N322S probably benign Het
Tlcd2 A G 11: 75,468,591 I70V probably benign Het
Tmem214 A G 5: 30,871,451 D128G possibly damaging Het
Trav13-4-dv7 T C 14: 53,757,781 V64A probably benign Het
Tyro3 T C 2: 119,802,364 W122R probably damaging Het
Ugcg A G 4: 59,213,246 D144G possibly damaging Het
Uimc1 T C 13: 55,031,015 D627G probably benign Het
Utp6 T C 11: 79,962,273 I13V probably benign Het
Vmn2r99 A G 17: 19,394,343 K775R probably damaging Het
Wdfy3 CG C 5: 101,882,961 probably null Het
Zw10 C T 9: 49,071,644 T525I probably benign Het
Other mutations in Dnah1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Dnah1 APN 14 31287873 missense probably benign 0.01
IGL00227:Dnah1 APN 14 31286896 missense probably damaging 1.00
IGL00491:Dnah1 APN 14 31261839 missense probably damaging 1.00
IGL00787:Dnah1 APN 14 31300063 missense possibly damaging 0.91
IGL00809:Dnah1 APN 14 31300809 nonsense probably null
IGL00911:Dnah1 APN 14 31304434 splice site probably null
IGL00949:Dnah1 APN 14 31307090 missense probably benign 0.00
IGL00976:Dnah1 APN 14 31278138 missense probably damaging 1.00
IGL01484:Dnah1 APN 14 31299940 missense probably damaging 0.98
IGL01629:Dnah1 APN 14 31292320 missense probably damaging 1.00
IGL01716:Dnah1 APN 14 31263378 missense probably benign 0.34
IGL01893:Dnah1 APN 14 31266470 missense probably damaging 1.00
IGL01933:Dnah1 APN 14 31310915 missense probably benign 0.40
IGL01938:Dnah1 APN 14 31283887 missense probably benign
IGL02032:Dnah1 APN 14 31274369 missense probably benign
IGL02052:Dnah1 APN 14 31268786 missense probably damaging 0.99
IGL02097:Dnah1 APN 14 31305001 missense possibly damaging 0.92
IGL02127:Dnah1 APN 14 31304928 missense probably benign 0.00
IGL02143:Dnah1 APN 14 31283289 missense probably damaging 1.00
IGL02158:Dnah1 APN 14 31300967 missense probably benign 0.00
IGL02442:Dnah1 APN 14 31287878 missense probably damaging 1.00
IGL02525:Dnah1 APN 14 31305833 missense probably benign 0.05
IGL02558:Dnah1 APN 14 31274379 missense possibly damaging 0.96
IGL02633:Dnah1 APN 14 31284815 missense probably benign 0.05
IGL02720:Dnah1 APN 14 31262220 missense probably damaging 0.96
IGL02728:Dnah1 APN 14 31283998 missense probably benign 0.44
IGL02738:Dnah1 APN 14 31292640 missense probably benign 0.27
IGL02863:Dnah1 APN 14 31295293 missense probably damaging 0.99
IGL02944:Dnah1 APN 14 31300871 missense possibly damaging 0.88
IGL03110:Dnah1 APN 14 31266717 missense probably benign 0.40
IGL03201:Dnah1 APN 14 31300949 missense probably benign 0.13
IGL03215:Dnah1 APN 14 31274391 missense probably damaging 1.00
IGL03230:Dnah1 APN 14 31270066 missense probably damaging 1.00
IGL03248:Dnah1 APN 14 31269889 missense probably damaging 1.00
IGL03267:Dnah1 APN 14 31286588 missense probably benign 0.00
IGL03299:Dnah1 APN 14 31315122 nonsense probably null
IGL03301:Dnah1 APN 14 31292692 missense probably damaging 1.00
ergonomic UTSW 14 31300748 missense possibly damaging 0.91
Faraday UTSW 14 31310882 missense probably null 0.05
K3955:Dnah1 UTSW 14 31266459 missense probably benign
PIT1430001:Dnah1 UTSW 14 31262580 missense probably damaging 1.00
R0043:Dnah1 UTSW 14 31274405 missense probably damaging 0.97
R0092:Dnah1 UTSW 14 31271609 missense probably benign 0.00
R0100:Dnah1 UTSW 14 31262152 critical splice donor site probably null
R0100:Dnah1 UTSW 14 31262152 critical splice donor site probably null
R0101:Dnah1 UTSW 14 31283899 missense probably damaging 1.00
R0119:Dnah1 UTSW 14 31276158 missense probably damaging 1.00
R0136:Dnah1 UTSW 14 31276158 missense probably damaging 1.00
R0144:Dnah1 UTSW 14 31267874 splice site probably benign
R0279:Dnah1 UTSW 14 31302375 missense possibly damaging 0.94
R0299:Dnah1 UTSW 14 31276158 missense probably damaging 1.00
R0316:Dnah1 UTSW 14 31278151 missense probably benign 0.00
R0739:Dnah1 UTSW 14 31265915 nonsense probably null
R0789:Dnah1 UTSW 14 31304591 missense probably benign
R0826:Dnah1 UTSW 14 31303907 missense probably benign 0.02
R1102:Dnah1 UTSW 14 31296457 nonsense probably null
R1116:Dnah1 UTSW 14 31307867 missense probably benign 0.13
R1229:Dnah1 UTSW 14 31310851 missense probably benign 0.11
R1447:Dnah1 UTSW 14 31306898 missense probably benign 0.06
R1449:Dnah1 UTSW 14 31263951 missense probably damaging 1.00
R1462:Dnah1 UTSW 14 31268781 splice site probably benign
R1482:Dnah1 UTSW 14 31294874 missense probably damaging 1.00
R1500:Dnah1 UTSW 14 31316758 missense probably benign
R1512:Dnah1 UTSW 14 31293037 missense probably damaging 1.00
R1591:Dnah1 UTSW 14 31272332 missense probably benign 0.01
R1598:Dnah1 UTSW 14 31301262 missense probably benign 0.07
R1644:Dnah1 UTSW 14 31302292 splice site probably benign
R1672:Dnah1 UTSW 14 31276200 missense probably damaging 1.00
R1713:Dnah1 UTSW 14 31279182 missense probably damaging 1.00
R1769:Dnah1 UTSW 14 31310882 missense probably null 0.05
R1796:Dnah1 UTSW 14 31261093 missense probably benign 0.00
R1902:Dnah1 UTSW 14 31319759 missense probably damaging 0.99
R1903:Dnah1 UTSW 14 31319759 missense probably damaging 0.99
R1905:Dnah1 UTSW 14 31264630 missense probably benign 0.06
R1908:Dnah1 UTSW 14 31262558 missense probably damaging 1.00
R1972:Dnah1 UTSW 14 31265391 nonsense probably null
R1973:Dnah1 UTSW 14 31265391 nonsense probably null
R2004:Dnah1 UTSW 14 31301856 missense possibly damaging 0.79
R2051:Dnah1 UTSW 14 31279123 missense probably damaging 1.00
R2062:Dnah1 UTSW 14 31271129 missense probably damaging 1.00
R2188:Dnah1 UTSW 14 31279164 missense probably damaging 0.98
R2240:Dnah1 UTSW 14 31299974 missense probably benign 0.00
R2862:Dnah1 UTSW 14 31284762 missense probably benign 0.21
R2894:Dnah1 UTSW 14 31298761 missense possibly damaging 0.67
R3120:Dnah1 UTSW 14 31266822 nonsense probably null
R3410:Dnah1 UTSW 14 31269817 missense possibly damaging 0.55
R3411:Dnah1 UTSW 14 31269817 missense possibly damaging 0.55
R3435:Dnah1 UTSW 14 31316674 missense probably damaging 0.96
R3615:Dnah1 UTSW 14 31315148 missense possibly damaging 0.92
R3616:Dnah1 UTSW 14 31315148 missense possibly damaging 0.92
R3741:Dnah1 UTSW 14 31265467 splice site probably benign
R3805:Dnah1 UTSW 14 31294763 missense possibly damaging 0.67
R3894:Dnah1 UTSW 14 31307028 missense probably benign
R4007:Dnah1 UTSW 14 31303784 splice site probably benign
R4201:Dnah1 UTSW 14 31262270 missense probably benign 0.00
R4232:Dnah1 UTSW 14 31304916 missense probably benign
R4372:Dnah1 UTSW 14 31304922 missense probably damaging 1.00
R4391:Dnah1 UTSW 14 31294835 missense probably damaging 1.00
R4423:Dnah1 UTSW 14 31284761 missense probably benign 0.00
R4526:Dnah1 UTSW 14 31285998 missense probably benign 0.05
R4650:Dnah1 UTSW 14 31284887 splice site probably null
R4723:Dnah1 UTSW 14 31272942 missense probably damaging 1.00
R4748:Dnah1 UTSW 14 31319945 missense probably benign
R4783:Dnah1 UTSW 14 31263479 missense probably damaging 1.00
R4784:Dnah1 UTSW 14 31263479 missense probably damaging 1.00
R4785:Dnah1 UTSW 14 31263479 missense probably damaging 1.00
R4843:Dnah1 UTSW 14 31264963 missense probably damaging 1.00
R4879:Dnah1 UTSW 14 31300748 missense possibly damaging 0.91
R4897:Dnah1 UTSW 14 31267539 missense probably damaging 1.00
R4911:Dnah1 UTSW 14 31295323 missense probably damaging 1.00
R4985:Dnah1 UTSW 14 31286898 missense probably null 1.00
R5070:Dnah1 UTSW 14 31282418 missense probably benign 0.05
R5128:Dnah1 UTSW 14 31296195 splice site probably null
R5409:Dnah1 UTSW 14 31263255 missense probably damaging 1.00
R5436:Dnah1 UTSW 14 31316747 missense probably benign
R5481:Dnah1 UTSW 14 31308871 missense possibly damaging 0.55
R5550:Dnah1 UTSW 14 31316708 missense probably benign 0.00
R5555:Dnah1 UTSW 14 31290819 missense probably damaging 0.99
R5566:Dnah1 UTSW 14 31274366 missense probably benign 0.35
R5623:Dnah1 UTSW 14 31286023 missense possibly damaging 0.62
R5701:Dnah1 UTSW 14 31274044 missense probably damaging 1.00
R5751:Dnah1 UTSW 14 31310906 missense probably benign 0.00
R5823:Dnah1 UTSW 14 31266418 missense possibly damaging 0.92
R6030:Dnah1 UTSW 14 31268027 missense probably damaging 1.00
R6030:Dnah1 UTSW 14 31268027 missense probably damaging 1.00
R6090:Dnah1 UTSW 14 31269425 missense possibly damaging 0.83
R6139:Dnah1 UTSW 14 31286027 missense probably benign 0.02
R6145:Dnah1 UTSW 14 31300970 missense probably benign 0.07
R6306:Dnah1 UTSW 14 31304587 missense probably damaging 0.97
R6376:Dnah1 UTSW 14 31275608 missense probably damaging 1.00
R6451:Dnah1 UTSW 14 31300808 missense probably benign 0.08
R6549:Dnah1 UTSW 14 31269383 missense probably damaging 1.00
R6748:Dnah1 UTSW 14 31299988 missense probably damaging 0.99
R6826:Dnah1 UTSW 14 31286290 missense probably benign 0.00
R6870:Dnah1 UTSW 14 31271061 nonsense probably null
R6932:Dnah1 UTSW 14 31287776 missense probably damaging 1.00
R6944:Dnah1 UTSW 14 31268904 missense probably damaging 1.00
R7033:Dnah1 UTSW 14 31264925 missense probably damaging 1.00
R7078:Dnah1 UTSW 14 31297110 missense probably damaging 1.00
R7133:Dnah1 UTSW 14 31286076 missense probably benign
R7136:Dnah1 UTSW 14 31298656 missense probably damaging 1.00
R7203:Dnah1 UTSW 14 31274382 missense probably benign
R7241:Dnah1 UTSW 14 31264939 missense probably benign 0.00
R7260:Dnah1 UTSW 14 31269386 missense probably damaging 1.00
R7264:Dnah1 UTSW 14 31269894 missense probably benign
R7291:Dnah1 UTSW 14 31298705 missense probably damaging 1.00
R7293:Dnah1 UTSW 14 31287863 missense probably damaging 1.00
R7300:Dnah1 UTSW 14 31269841 missense probably benign 0.05
R7319:Dnah1 UTSW 14 31296594 missense probably benign 0.02
R7323:Dnah1 UTSW 14 31298707 missense probably damaging 1.00
R7472:Dnah1 UTSW 14 31261590 missense probably damaging 1.00
R7472:Dnah1 UTSW 14 31300791 missense possibly damaging 0.80
R7499:Dnah1 UTSW 14 31315122 nonsense probably null
R7526:Dnah1 UTSW 14 31287876 missense possibly damaging 0.49
R7560:Dnah1 UTSW 14 31304983 missense probably benign
R7574:Dnah1 UTSW 14 31319908 missense probably benign 0.00
R7617:Dnah1 UTSW 14 31284782 missense possibly damaging 0.80
R7620:Dnah1 UTSW 14 31303906 missense possibly damaging 0.47
R7692:Dnah1 UTSW 14 31292338 missense probably benign 0.00
R7702:Dnah1 UTSW 14 31310909 missense probably benign
R7786:Dnah1 UTSW 14 31262521 missense probably damaging 1.00
RF006:Dnah1 UTSW 14 31307875 missense probably benign 0.08
Z1088:Dnah1 UTSW 14 31304811 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TGAAAGCCCCGCAGATAGAC -3'
(R):5'- AACAAGTTGGTGGCTCCCTC -3'

Sequencing Primer
(F):5'- CGCAGATAGACTAGACAGATCCTG -3'
(R):5'- TGGTGGCTCCCTCTGCATG -3'
Posted On2019-06-07