Incidental Mutation 'PIT4382001:Runx1'
ID554722
Institutional Source Beutler Lab
Gene Symbol Runx1
Ensembl Gene ENSMUSG00000022952
Gene Namerunt related transcription factor 1
SynonymsAML1, Pebp2a2, Cbfa2, runt domain, alpha subunit 2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4382001 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location92601466-92826149 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 92613760 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 256 (D256V)
Ref Sequence ENSEMBL: ENSMUSP00000023673 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023673] [ENSMUST00000113956] [ENSMUST00000168195]
Predicted Effect probably damaging
Transcript: ENSMUST00000023673
AA Change: D256V

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023673
Gene: ENSMUSG00000022952
AA Change: D256V

DomainStartEndE-ValueType
low complexity region 42 55 N/A INTRINSIC
Pfam:Runt 65 194 4.5e-75 PFAM
low complexity region 205 220 N/A INTRINSIC
PDB:1B8X|A 333 374 2e-7 PDB
Pfam:RunxI 375 465 1.5e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113956
AA Change: N178I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000109589
Gene: ENSMUSG00000022952
AA Change: N178I

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
Pfam:Runt 48 182 3.1e-81 PFAM
low complexity region 270 283 N/A INTRINSIC
Pfam:RunxI 294 387 4.9e-43 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000168195
AA Change: D242V

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131079
Gene: ENSMUSG00000022952
AA Change: D242V

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
Pfam:Runt 48 182 4.7e-82 PFAM
low complexity region 191 206 N/A INTRINSIC
low complexity region 334 347 N/A INTRINSIC
Pfam:RunxI 358 451 6.4e-43 PFAM
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.5%
  • 10x: 84.6%
  • 20x: 72.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Core binding factor (CBF) is a heterodimeric transcription factor that binds to the core element of many enhancers and promoters. The protein encoded by this gene represents the alpha subunit of CBF and is thought to be involved in the development of normal hematopoiesis. Chromosomal translocations involving this gene are well-documented and have been associated with several types of leukemia. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations affect hematopoiesis, and in some cases result in defective angiogenesis and intraventricular hemorrhage. Null homozygotes die by embryonic day 12.5; heterozygotes have reduced erythroid and myeloid progenitor numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430038I01Rik G T 7: 137,376,982 H144N unknown Het
Acsm4 C T 7: 119,698,575 T145M probably damaging Het
Adam10 T C 9: 70,766,081 L498P probably damaging Het
Adgrl2 A G 3: 148,817,298 L430P Het
Alk T C 17: 71,949,921 M648V probably benign Het
Arhgap35 T C 7: 16,563,869 R424G possibly damaging Het
Baiap2l1 T C 5: 144,278,670 K342E possibly damaging Het
Ccdc54 C T 16: 50,590,856 V16M probably damaging Het
Chil3 T G 3: 106,148,659 D366A probably damaging Het
Chuk A G 19: 44,098,607 V151A probably damaging Het
Cpd T G 11: 76,797,788 H886P probably benign Het
Cped1 T A 6: 22,222,450 C736* probably null Het
Creb3l3 T C 10: 81,084,912 E428G probably benign Het
Csad G A 15: 102,188,650 L7F probably benign Het
Dnah1 C T 14: 31,284,455 D2255N probably damaging Het
Dnajb12 T C 10: 59,892,686 Y159H probably damaging Het
Dpysl4 T A 7: 139,089,578 Y57* probably null Het
F2rl1 T G 13: 95,513,646 N243H probably benign Het
Fhl4 T C 10: 85,098,429 K163E possibly damaging Het
Flot2 T C 11: 78,053,367 S46P possibly damaging Het
Fsip2 C A 2: 82,990,852 T5643K possibly damaging Het
Gm853 A T 4: 130,219,161 N147K possibly damaging Het
Gm8765 A T 13: 50,700,971 E215V probably damaging Het
Golga4 T A 9: 118,553,453 Y542N possibly damaging Het
Il17re A G 6: 113,469,077 T426A probably benign Het
Kdm2a T A 19: 4,343,173 M385L probably benign Het
Kdm3b T C 18: 34,809,087 S744P probably damaging Het
Krtap6-3 T A 16: 89,084,160 Y26* probably null Het
Lama2 T C 10: 27,204,905 D974G probably damaging Het
Lipo5 A T 19: 33,465,939 L159Q probably null Het
Mau2 C T 8: 70,030,652 E187K possibly damaging Het
Mrpl9 T C 3: 94,447,829 L236P probably benign Het
Mta1 A G 12: 113,133,250 T564A probably benign Het
Mylk C T 16: 34,875,642 S249L probably damaging Het
Ncor1 G T 11: 62,344,663 T331K probably damaging Het
Nsun3 T A 16: 62,785,865 K15N probably damaging Het
Nsun5 A G 5: 135,371,501 Y132C probably benign Het
Obsl1 T A 1: 75,487,963 T1605S probably benign Het
Olfr1463 T C 19: 13,234,895 I215T probably damaging Het
Olfr519 A G 7: 108,894,102 Y107H probably damaging Het
Olfr566 A G 7: 102,856,602 Y227H probably damaging Het
Olfr574 A T 7: 102,949,449 Y328F probably benign Het
Oraov1 T A 7: 144,916,444 Y37N probably damaging Het
P2rx1 A G 11: 73,009,200 N148D probably benign Het
Pogz T A 3: 94,879,796 S1232T probably damaging Het
Polr3b C A 10: 84,684,185 T655N probably damaging Het
Prss34 T C 17: 25,298,908 probably null Het
Rhpn2 A G 7: 35,390,753 probably null Het
Shc1 C A 3: 89,427,408 Q525K probably benign Het
Slc10a5 T C 3: 10,335,447 D51G probably benign Het
Slc6a3 A T 13: 73,571,523 N557I probably benign Het
Slmap C T 14: 26,533,431 R32H probably damaging Het
Spata31d1c T C 13: 65,036,171 I509T probably benign Het
Srr C A 11: 74,910,308 V138F probably benign Het
Tas2r118 G A 6: 23,969,786 T92I possibly damaging Het
Tcaf2 A T 6: 42,624,366 *920K probably null Het
Tenm2 T A 11: 36,063,902 Y1141F probably damaging Het
Thoc6 T C 17: 23,668,867 N322S probably benign Het
Tlcd2 A G 11: 75,468,591 I70V probably benign Het
Tmem214 A G 5: 30,871,451 D128G possibly damaging Het
Trav13-4-dv7 T C 14: 53,757,781 V64A probably benign Het
Tyro3 T C 2: 119,802,364 W122R probably damaging Het
Ugcg A G 4: 59,213,246 D144G possibly damaging Het
Uimc1 T C 13: 55,031,015 D627G probably benign Het
Utp6 T C 11: 79,962,273 I13V probably benign Het
Vmn2r99 A G 17: 19,394,343 K775R probably damaging Het
Wdfy3 CG C 5: 101,882,961 probably null Het
Zw10 C T 9: 49,071,644 T525I probably benign Het
Other mutations in Runx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0055:Runx1 UTSW 16 92644141 splice site probably benign
R0315:Runx1 UTSW 16 92605767 missense probably damaging 0.99
R1353:Runx1 UTSW 16 92689051 nonsense probably null
R4059:Runx1 UTSW 16 92644246 missense probably benign 0.09
R4771:Runx1 UTSW 16 92695741 missense possibly damaging 0.70
R4977:Runx1 UTSW 16 92644347 critical splice acceptor site probably null
R5631:Runx1 UTSW 16 92695563 missense possibly damaging 0.94
R6257:Runx1 UTSW 16 92695911 unclassified probably benign
R6435:Runx1 UTSW 16 92644295 missense possibly damaging 0.53
Z1088:Runx1 UTSW 16 92605792 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTCCATTAGCCATGTCCC -3'
(R):5'- AACAGAGTCATCAAATACTTGGGC -3'

Sequencing Primer
(F):5'- CCCGCTGCAGGTGTGTTTTC -3'
(R):5'- CATCAAATACTTGGGCTCTAGTGGTC -3'
Posted On2019-06-07