Incidental Mutation 'PIT4382001:Vmn2r99'
ID 554723
Institutional Source Beutler Lab
Gene Symbol Vmn2r99
Ensembl Gene ENSMUSG00000090304
Gene Name vomeronasal 2, receptor 99
Synonyms EG665376
Accession Numbers
Essential gene? Probably non essential (E-score: 0.164) question?
Stock # PIT4382001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 19582397-19614852 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 19614605 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 775 (K775R)
Ref Sequence ENSEMBL: ENSMUSP00000135236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176107] [ENSMUST00000231989]
AlphaFold H3BK37
Predicted Effect probably damaging
Transcript: ENSMUST00000176107
AA Change: K775R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135236
Gene: ENSMUSG00000090304
AA Change: K775R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 81 448 5.7e-33 PFAM
Pfam:NCD3G 508 561 1.8e-21 PFAM
Pfam:7tm_3 593 829 4.6e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000231989
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.5%
  • 10x: 84.6%
  • 20x: 72.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430038I01Rik G T 7: 136,978,711 (GRCm39) H144N unknown Het
Acsm4 C T 7: 119,297,798 (GRCm39) T145M probably damaging Het
Adam10 T C 9: 70,673,363 (GRCm39) L498P probably damaging Het
Adgrl2 A G 3: 148,522,934 (GRCm39) L430P Het
Alk T C 17: 72,256,916 (GRCm39) M648V probably benign Het
Arhgap35 T C 7: 16,297,794 (GRCm39) R424G possibly damaging Het
Baiap2l1 T C 5: 144,215,480 (GRCm39) K342E possibly damaging Het
Ccdc54 C T 16: 50,411,219 (GRCm39) V16M probably damaging Het
Chil3 T G 3: 106,055,975 (GRCm39) D366A probably damaging Het
Chuk A G 19: 44,087,046 (GRCm39) V151A probably damaging Het
Cpd T G 11: 76,688,614 (GRCm39) H886P probably benign Het
Cped1 T A 6: 22,222,449 (GRCm39) C736* probably null Het
Creb3l3 T C 10: 80,920,746 (GRCm39) E428G probably benign Het
Csad G A 15: 102,097,085 (GRCm39) L7F probably benign Het
Dnah1 C T 14: 31,006,412 (GRCm39) D2255N probably damaging Het
Dnajb12 T C 10: 59,728,508 (GRCm39) Y159H probably damaging Het
Dpysl4 T A 7: 138,669,494 (GRCm39) Y57* probably null Het
F2rl1 T G 13: 95,650,154 (GRCm39) N243H probably benign Het
Fhl4 T C 10: 84,934,293 (GRCm39) K163E possibly damaging Het
Flot2 T C 11: 77,944,193 (GRCm39) S46P possibly damaging Het
Fsip2 C A 2: 82,821,196 (GRCm39) T5643K possibly damaging Het
Golga4 T A 9: 118,382,521 (GRCm39) Y542N possibly damaging Het
Il17re A G 6: 113,446,038 (GRCm39) T426A probably benign Het
Kdm2a T A 19: 4,393,201 (GRCm39) M385L probably benign Het
Kdm3b T C 18: 34,942,140 (GRCm39) S744P probably damaging Het
Krtap20-1 T A 16: 88,881,048 (GRCm39) Y26* probably null Het
Lama2 T C 10: 27,080,901 (GRCm39) D974G probably damaging Het
Ldc1 A T 4: 130,112,954 (GRCm39) N147K possibly damaging Het
Lipo5 A T 19: 33,443,339 (GRCm39) L159Q probably null Het
LTO1 T A 7: 144,470,181 (GRCm39) Y37N probably damaging Het
Mau2 C T 8: 70,483,302 (GRCm39) E187K possibly damaging Het
Mrpl9 T C 3: 94,355,136 (GRCm39) L236P probably benign Het
Mta1 A G 12: 113,096,870 (GRCm39) T564A probably benign Het
Mylk C T 16: 34,696,012 (GRCm39) S249L probably damaging Het
Ncor1 G T 11: 62,235,489 (GRCm39) T331K probably damaging Het
Nsun3 T A 16: 62,606,228 (GRCm39) K15N probably damaging Het
Nsun5 A G 5: 135,400,355 (GRCm39) Y132C probably benign Het
Obsl1 T A 1: 75,464,607 (GRCm39) T1605S probably benign Het
Or10a3n A G 7: 108,493,309 (GRCm39) Y107H probably damaging Het
Or51f1 A G 7: 102,505,809 (GRCm39) Y227H probably damaging Het
Or51t4 A T 7: 102,598,656 (GRCm39) Y328F probably benign Het
Or5b109 T C 19: 13,212,259 (GRCm39) I215T probably damaging Het
P2rx1 A G 11: 72,900,026 (GRCm39) N148D probably benign Het
Pogz T A 3: 94,787,107 (GRCm39) S1232T probably damaging Het
Polr3b C A 10: 84,520,049 (GRCm39) T655N probably damaging Het
Prss34 T C 17: 25,517,882 (GRCm39) probably null Het
Rhpn2 A G 7: 35,090,178 (GRCm39) probably null Het
Runx1 T A 16: 92,410,648 (GRCm39) D256V probably damaging Het
Shc1 C A 3: 89,334,715 (GRCm39) Q525K probably benign Het
Slc10a5 T C 3: 10,400,507 (GRCm39) D51G probably benign Het
Slc6a3 A T 13: 73,719,642 (GRCm39) N557I probably benign Het
Slmap C T 14: 26,254,586 (GRCm39) R32H probably damaging Het
Spata31d1c T C 13: 65,183,985 (GRCm39) I509T probably benign Het
Spata31e4 A T 13: 50,855,007 (GRCm39) E215V probably damaging Het
Srr C A 11: 74,801,134 (GRCm39) V138F probably benign Het
Tas2r118 G A 6: 23,969,785 (GRCm39) T92I possibly damaging Het
Tcaf2 A T 6: 42,601,300 (GRCm39) *920K probably null Het
Tenm2 T A 11: 35,954,729 (GRCm39) Y1141F probably damaging Het
Thoc6 T C 17: 23,887,841 (GRCm39) N322S probably benign Het
Tlcd2 A G 11: 75,359,417 (GRCm39) I70V probably benign Het
Tmem214 A G 5: 31,028,795 (GRCm39) D128G possibly damaging Het
Trav13d-4 T C 14: 53,995,238 (GRCm39) V64A probably benign Het
Tyro3 T C 2: 119,632,845 (GRCm39) W122R probably damaging Het
Ugcg A G 4: 59,213,246 (GRCm39) D144G possibly damaging Het
Uimc1 T C 13: 55,178,828 (GRCm39) D627G probably benign Het
Utp6 T C 11: 79,853,099 (GRCm39) I13V probably benign Het
Wdfy3 CG C 5: 102,030,827 (GRCm39) probably null Het
Zw10 C T 9: 48,982,944 (GRCm39) T525I probably benign Het
Other mutations in Vmn2r99
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Vmn2r99 APN 17 19,599,116 (GRCm39) missense probably benign 0.01
IGL01113:Vmn2r99 APN 17 19,614,518 (GRCm39) missense probably benign 0.20
IGL01138:Vmn2r99 APN 17 19,602,885 (GRCm39) missense probably damaging 0.97
IGL01646:Vmn2r99 APN 17 19,613,920 (GRCm39) splice site probably benign
IGL01769:Vmn2r99 APN 17 19,600,377 (GRCm39) missense probably damaging 1.00
IGL02112:Vmn2r99 APN 17 19,600,494 (GRCm39) missense probably null 0.99
IGL02891:Vmn2r99 APN 17 19,598,952 (GRCm39) nonsense probably null
IGL03132:Vmn2r99 APN 17 19,598,485 (GRCm39) nonsense probably null
FR4548:Vmn2r99 UTSW 17 19,614,547 (GRCm39) missense probably damaging 0.97
FR4976:Vmn2r99 UTSW 17 19,614,547 (GRCm39) missense probably damaging 0.97
R0196:Vmn2r99 UTSW 17 19,614,835 (GRCm39) missense probably benign 0.00
R0720:Vmn2r99 UTSW 17 19,599,305 (GRCm39) missense probably benign 0.00
R1501:Vmn2r99 UTSW 17 19,582,521 (GRCm39) missense possibly damaging 0.93
R1519:Vmn2r99 UTSW 17 19,600,322 (GRCm39) missense probably benign 0.00
R1670:Vmn2r99 UTSW 17 19,582,514 (GRCm39) missense probably benign 0.37
R1682:Vmn2r99 UTSW 17 19,598,207 (GRCm39) missense probably damaging 0.97
R1873:Vmn2r99 UTSW 17 19,582,415 (GRCm39) missense probably benign 0.25
R1967:Vmn2r99 UTSW 17 19,599,077 (GRCm39) missense probably benign 0.01
R2101:Vmn2r99 UTSW 17 19,598,253 (GRCm39) missense probably damaging 1.00
R2474:Vmn2r99 UTSW 17 19,598,891 (GRCm39) missense probably benign 0.04
R2519:Vmn2r99 UTSW 17 19,598,970 (GRCm39) missense probably damaging 0.99
R3911:Vmn2r99 UTSW 17 19,614,635 (GRCm39) missense possibly damaging 0.92
R3947:Vmn2r99 UTSW 17 19,599,252 (GRCm39) missense probably benign 0.40
R3949:Vmn2r99 UTSW 17 19,599,252 (GRCm39) missense probably benign 0.40
R4016:Vmn2r99 UTSW 17 19,598,832 (GRCm39) missense possibly damaging 0.86
R4413:Vmn2r99 UTSW 17 19,599,522 (GRCm39) missense probably damaging 1.00
R4594:Vmn2r99 UTSW 17 19,613,924 (GRCm39) missense probably damaging 1.00
R4999:Vmn2r99 UTSW 17 19,582,397 (GRCm39) start codon destroyed probably null 0.96
R5206:Vmn2r99 UTSW 17 19,598,868 (GRCm39) missense probably benign 0.40
R5362:Vmn2r99 UTSW 17 19,599,601 (GRCm39) missense probably benign 0.00
R5377:Vmn2r99 UTSW 17 19,599,531 (GRCm39) missense probably damaging 1.00
R5455:Vmn2r99 UTSW 17 19,614,408 (GRCm39) nonsense probably null
R6021:Vmn2r99 UTSW 17 19,598,210 (GRCm39) missense probably damaging 1.00
R6059:Vmn2r99 UTSW 17 19,599,242 (GRCm39) missense probably benign 0.00
R6214:Vmn2r99 UTSW 17 19,602,820 (GRCm39) missense probably benign 0.19
R6215:Vmn2r99 UTSW 17 19,602,820 (GRCm39) missense probably benign 0.19
R6313:Vmn2r99 UTSW 17 19,602,867 (GRCm39) missense probably damaging 1.00
R6646:Vmn2r99 UTSW 17 19,600,293 (GRCm39) missense probably damaging 1.00
R6810:Vmn2r99 UTSW 17 19,600,296 (GRCm39) missense probably benign 0.20
R6885:Vmn2r99 UTSW 17 19,600,457 (GRCm39) missense possibly damaging 0.52
R6991:Vmn2r99 UTSW 17 19,598,372 (GRCm39) missense probably benign 0.03
R7060:Vmn2r99 UTSW 17 19,614,826 (GRCm39) nonsense probably null
R7090:Vmn2r99 UTSW 17 19,613,972 (GRCm39) missense possibly damaging 0.83
R7094:Vmn2r99 UTSW 17 19,599,573 (GRCm39) missense probably benign 0.00
R7449:Vmn2r99 UTSW 17 19,599,407 (GRCm39) missense probably benign 0.01
R7789:Vmn2r99 UTSW 17 19,614,079 (GRCm39) missense possibly damaging 0.91
R8039:Vmn2r99 UTSW 17 19,600,302 (GRCm39) missense probably benign 0.00
R8493:Vmn2r99 UTSW 17 19,614,020 (GRCm39) missense probably benign 0.15
R8511:Vmn2r99 UTSW 17 19,614,443 (GRCm39) missense probably damaging 1.00
R8715:Vmn2r99 UTSW 17 19,613,922 (GRCm39) critical splice acceptor site probably benign
R9462:Vmn2r99 UTSW 17 19,598,388 (GRCm39) nonsense probably null
R9681:Vmn2r99 UTSW 17 19,598,889 (GRCm39) missense probably damaging 1.00
R9737:Vmn2r99 UTSW 17 19,582,563 (GRCm39) missense probably benign
Z1088:Vmn2r99 UTSW 17 19,599,563 (GRCm39) missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- AAACTACATCATTCCTGTCTGCAC -3'
(R):5'- CAGCAAGATAATGTAACACTTGGGAC -3'

Sequencing Primer
(F):5'- ATTTGTGGAATATGGATGGCAAC -3'
(R):5'- CACTTGGGACCAAATATGAAGAC -3'
Posted On 2019-06-07