Incidental Mutation 'PIT4366001:Astn1'
ID554736
Institutional Source Beutler Lab
Gene Symbol Astn1
Ensembl Gene ENSMUSG00000026587
Gene Nameastrotactin 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #PIT4366001 (G1)
Quality Score199.009
Status Not validated
Chromosome1
Chromosomal Location158362273-158691781 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 158597211 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 656 (I656F)
Ref Sequence ENSEMBL: ENSMUSP00000142322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046110] [ENSMUST00000170718] [ENSMUST00000193042] [ENSMUST00000193599] [ENSMUST00000194369] [ENSMUST00000195311]
Predicted Effect probably benign
Transcript: ENSMUST00000046110
AA Change: I648F

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000039711
Gene: ENSMUSG00000026587
AA Change: I648F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 153 175 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
transmembrane domain 388 410 N/A INTRINSIC
EGF 462 507 1.2e1 SMART
EGF 611 652 2.29e1 SMART
EGF_like 659 708 3.57e1 SMART
MACPF 811 999 1.11e-56 SMART
FN3 1030 1142 5.75e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000170718
AA Change: I656F

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000127428
Gene: ENSMUSG00000026587
AA Change: I656F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 153 175 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
transmembrane domain 388 410 N/A INTRINSIC
EGF 462 507 1.2e1 SMART
EGF 611 652 2.29e1 SMART
EGF_like 659 708 3.57e1 SMART
Blast:MACPF 811 835 3e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000193042
AA Change: I656F

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000142322
Gene: ENSMUSG00000026587
AA Change: I656F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 153 175 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
transmembrane domain 388 410 N/A INTRINSIC
EGF 462 507 1.2e1 SMART
EGF 611 652 2.29e1 SMART
EGF_like 659 708 3.57e1 SMART
MACPF 811 999 1.11e-56 SMART
FN3 1030 1142 5.75e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193599
AA Change: I146F

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000141498
Gene: ENSMUSG00000026587
AA Change: I146F

DomainStartEndE-ValueType
EGF 101 142 1.1e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000194369
AA Change: I648F

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000142017
Gene: ENSMUSG00000026587
AA Change: I648F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 153 175 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
transmembrane domain 388 410 N/A INTRINSIC
EGF 462 499 2e-2 SMART
EGF 603 644 1.1e-1 SMART
EGF_like 651 700 1.7e-1 SMART
Blast:MACPF 803 828 2e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000195311
AA Change: I648F

PolyPhen 2 Score 0.227 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000141518
Gene: ENSMUSG00000026587
AA Change: I648F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 153 175 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
transmembrane domain 388 410 N/A INTRINSIC
EGF 462 499 2e-2 SMART
EGF 603 644 1.1e-1 SMART
EGF_like 651 700 1.7e-1 SMART
MACPF 803 991 6.2e-59 SMART
FN3 1022 1134 2.8e-4 SMART
Coding Region Coverage
  • 1x: 93.0%
  • 3x: 90.7%
  • 10x: 85.5%
  • 20x: 73.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Astrotactin is a neuronal adhesion molecule required for glial-guided migration of young postmitotic neuroblasts in cortical regions of developing brain, including cerebrum, hippocampus, cerebellum, and olfactory bulb (Fink et al., 1995).[supplied by OMIM, Jun 2009]
PHENOTYPE: Homozygous mutation of this gene results in reduced cerebellum size, abnormal Purkinje cell morphology, and reduced coordination performance on the Rotarod test. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C A 11: 120,010,960 S870I possibly damaging Het
Abca13 T C 11: 9,294,962 V2275A probably benign Het
Abcb5 T C 12: 118,936,098 K278R probably damaging Het
Adcy2 TA TAA 13: 68,709,990 probably benign Het
Add3 C T 19: 53,216,867 P16L unknown Het
Akap9 T A 5: 4,046,221 D2365E probably benign Het
Asah1 A G 8: 41,343,746 S300P possibly damaging Het
Bmpr1b T A 3: 141,880,463 T13S probably benign Het
Camsap2 A G 1: 136,280,317 F478L Het
Card10 G A 15: 78,787,431 S611L probably benign Het
Cep68 T C 11: 20,240,007 N335S probably benign Het
Chac1 T C 2: 119,351,505 W35R probably damaging Het
Cntn6 T C 6: 104,832,537 V511A probably benign Het
Cpne9 G T 6: 113,294,746 G356W probably damaging Het
Dnah10 C A 5: 124,775,524 T1939K possibly damaging Het
Dock10 T C 1: 80,595,721 N239D probably benign Het
Dock5 T C 14: 67,824,674 K415R possibly damaging Het
Dtd2 C A 12: 51,999,799 D86Y probably damaging Het
Efcab9 A G 11: 32,523,608 F127S probably damaging Het
Ermp1 T C 19: 29,628,789 H375R probably benign Het
Frem2 A T 3: 53,653,201 M1295K probably damaging Het
Gbp7 T G 3: 142,542,951 I325R probably benign Het
Gpr179 T C 11: 97,336,851 K1493E probably benign Het
Gucy2g T A 19: 55,237,782 E234V probably null Het
Itpr1 T A 6: 108,493,757 C2215* probably null Het
Ltn1 G A 16: 87,380,840 R1634* probably null Het
Lynx1 A T 15: 74,751,409 M58K possibly damaging Het
Macc1 T C 12: 119,446,949 V484A probably benign Het
Map3k9 C T 12: 81,772,761 V240M possibly damaging Het
Marc1 A G 1: 184,807,186 F96S probably benign Het
Mars A G 10: 127,299,398 M608T possibly damaging Het
Mc2r T C 18: 68,407,755 M156V probably benign Het
Mchr1 G T 15: 81,237,216 V56L probably benign Het
Mlxip C T 5: 123,395,110 P61S probably benign Het
Muc4 A G 16: 32,754,796 T1557A unknown Het
Myt1 T C 2: 181,825,938 V1135A probably damaging Het
Ndufaf6 A T 4: 11,073,215 S76T probably benign Het
Ntrk2 A G 13: 59,060,335 Y665C probably damaging Het
Oaz3 T G 3: 94,433,594 R215S unknown Het
Olfr1022 T C 2: 85,868,882 C97R probably damaging Het
Olfr1031 A T 2: 85,992,041 N75Y probably damaging Het
Olfr1133 C T 2: 87,645,190 W311* probably null Het
Olfr417 T C 1: 174,369,090 Y58H probably damaging Het
Perm1 G T 4: 156,218,735 V579L probably benign Het
Phyhipl A G 10: 70,568,958 V140A probably benign Het
Pip5k1c T A 10: 81,309,008 S228T probably damaging Het
Plekhn1 T G 4: 156,224,811 T213P probably damaging Het
Pomt2 A T 12: 87,116,529 probably null Het
Ptcd1 A G 5: 145,151,335 V622A probably benign Het
Ptn T A 6: 36,741,349 H127L probably benign Het
Ptprk A T 10: 28,586,019 M1193L probably benign Het
Ptpru G A 4: 131,799,712 P650S probably benign Het
Pum2 T A 12: 8,733,390 L613Q probably damaging Het
Rapgef6 A G 11: 54,691,620 T1458A probably damaging Het
Sap130 C T 18: 31,677,409 A470V probably benign Het
Sertad2 C A 11: 20,648,116 P104Q probably benign Het
Sfrp4 A T 13: 19,630,244 M324L unknown Het
Sh3bp4 A G 1: 89,145,434 N668S probably benign Het
Snx30 C A 4: 59,894,653 D410E probably benign Het
Spata31 C A 13: 64,921,505 S489* probably null Het
Taok3 T A 5: 117,227,985 M367K probably benign Het
Tfap2a T C 13: 40,721,374 N254D possibly damaging Het
Tgtp1 T G 11: 48,987,040 L279F possibly damaging Het
Tmpo A G 10: 91,163,310 F205S probably damaging Het
Tmprss5 A T 9: 49,112,217 I218L probably benign Het
Tti2 A G 8: 31,151,196 E116G probably benign Het
Vmn2r59 A T 7: 42,045,781 N402K possibly damaging Het
Other mutations in Astn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Astn1 APN 1 158600319 missense possibly damaging 0.71
IGL01705:Astn1 APN 1 158504313 missense probably damaging 1.00
IGL01790:Astn1 APN 1 158580327 missense possibly damaging 0.70
IGL01962:Astn1 APN 1 158668631 missense probably damaging 1.00
IGL02000:Astn1 APN 1 158674614 missense probably damaging 1.00
IGL02119:Astn1 APN 1 158511154 intron probably benign
IGL02168:Astn1 APN 1 158609341 missense possibly damaging 0.93
IGL02239:Astn1 APN 1 158664130 critical splice donor site probably null
IGL02271:Astn1 APN 1 158510950 splice site probably benign
IGL02307:Astn1 APN 1 158674614 missense probably damaging 1.00
IGL02504:Astn1 APN 1 158502408 missense probably damaging 1.00
IGL02552:Astn1 APN 1 158505395 missense possibly damaging 0.90
IGL02903:Astn1 APN 1 158688550 missense probably damaging 0.99
IGL03003:Astn1 APN 1 158612395 missense probably benign 0.00
IGL03007:Astn1 APN 1 158668623 splice site probably benign
IGL03354:Astn1 APN 1 158688604 missense probably damaging 1.00
PIT4366001:Astn1 UTSW 1 158597209 missense probably benign 0.20
R0024:Astn1 UTSW 1 158684215 missense probably damaging 0.99
R0050:Astn1 UTSW 1 158579724 splice site probably benign
R0099:Astn1 UTSW 1 158502151 missense probably damaging 1.00
R0109:Astn1 UTSW 1 158664104 missense possibly damaging 0.79
R0109:Astn1 UTSW 1 158664104 missense possibly damaging 0.79
R0365:Astn1 UTSW 1 158688548 missense probably damaging 1.00
R0416:Astn1 UTSW 1 158509891 missense probably damaging 1.00
R0531:Astn1 UTSW 1 158600389 missense probably damaging 0.99
R0735:Astn1 UTSW 1 158472389 missense possibly damaging 0.53
R0763:Astn1 UTSW 1 158509890 missense possibly damaging 0.93
R0899:Astn1 UTSW 1 158511109 nonsense probably null
R1027:Astn1 UTSW 1 158580279 missense probably damaging 1.00
R1160:Astn1 UTSW 1 158600365 missense possibly damaging 0.83
R1474:Astn1 UTSW 1 158502353 missense probably damaging 1.00
R1517:Astn1 UTSW 1 158579576 splice site probably benign
R1701:Astn1 UTSW 1 158504307 missense possibly damaging 0.54
R1764:Astn1 UTSW 1 158504251 missense probably benign 0.35
R1860:Astn1 UTSW 1 158601945 missense probably damaging 1.00
R1889:Astn1 UTSW 1 158505316 intron probably null
R1919:Astn1 UTSW 1 158509971 missense probably damaging 1.00
R2001:Astn1 UTSW 1 158520521 missense probably damaging 1.00
R2007:Astn1 UTSW 1 158609305 missense probably damaging 0.97
R2038:Astn1 UTSW 1 158657120 missense probably benign 0.29
R2044:Astn1 UTSW 1 158600502 missense possibly damaging 0.53
R2084:Astn1 UTSW 1 158472408 missense probably damaging 0.99
R2094:Astn1 UTSW 1 158667609 missense probably benign 0.02
R2163:Astn1 UTSW 1 158502150 missense probably damaging 0.99
R2211:Astn1 UTSW 1 158657306 missense probably benign 0.40
R2268:Astn1 UTSW 1 158502099 missense probably damaging 1.00
R2269:Astn1 UTSW 1 158502099 missense probably damaging 1.00
R2425:Astn1 UTSW 1 158579666 missense probably damaging 0.99
R2428:Astn1 UTSW 1 158612346 missense possibly damaging 0.66
R2980:Astn1 UTSW 1 158572951 critical splice acceptor site probably null
R3713:Astn1 UTSW 1 158667532 missense possibly damaging 0.83
R3745:Astn1 UTSW 1 158502060 missense probably damaging 1.00
R3926:Astn1 UTSW 1 158579657 missense possibly damaging 0.95
R4345:Astn1 UTSW 1 158502032 intron probably null
R4625:Astn1 UTSW 1 158580294 missense probably damaging 1.00
R4627:Astn1 UTSW 1 158502251 missense possibly damaging 0.55
R4970:Astn1 UTSW 1 158657193 missense possibly damaging 0.88
R5112:Astn1 UTSW 1 158657193 missense possibly damaging 0.88
R5257:Astn1 UTSW 1 158612532 missense probably damaging 1.00
R5292:Astn1 UTSW 1 158580363 critical splice donor site probably null
R5889:Astn1 UTSW 1 158600380 missense possibly damaging 0.93
R5909:Astn1 UTSW 1 158601937 missense probably damaging 1.00
R6020:Astn1 UTSW 1 158509993 missense probably damaging 1.00
R6349:Astn1 UTSW 1 158664121 nonsense probably null
R6481:Astn1 UTSW 1 158612462 missense probably benign 0.29
R6736:Astn1 UTSW 1 158511148 critical splice donor site probably null
R6833:Astn1 UTSW 1 158664122 missense probably benign 0.40
R6834:Astn1 UTSW 1 158664122 missense probably benign 0.40
R6860:Astn1 UTSW 1 158612472 missense probably damaging 1.00
R6874:Astn1 UTSW 1 158664074 nonsense probably null
R7062:Astn1 UTSW 1 158688511 critical splice acceptor site probably null
R7133:Astn1 UTSW 1 158572987 missense probably damaging 1.00
R7355:Astn1 UTSW 1 158664276 intron probably null
R7402:Astn1 UTSW 1 158552855 intron probably benign
R7412:Astn1 UTSW 1 158502349 missense probably damaging 0.98
R7487:Astn1 UTSW 1 158610782 intron probably null
R7537:Astn1 UTSW 1 158505386 missense possibly damaging 0.84
R7537:Astn1 UTSW 1 158667638 splice site probably null
R7635:Astn1 UTSW 1 158667535 nonsense probably null
R7890:Astn1 UTSW 1 158580333 missense probably damaging 1.00
R7894:Astn1 UTSW 1 158601938 missense probably damaging 0.98
R7904:Astn1 UTSW 1 158597316 missense probably benign 0.37
R7973:Astn1 UTSW 1 158580333 missense probably damaging 1.00
R7977:Astn1 UTSW 1 158601938 missense probably damaging 0.98
R7987:Astn1 UTSW 1 158597316 missense probably benign 0.37
R8048:Astn1 UTSW 1 158688638 missense probably benign 0.00
R8061:Astn1 UTSW 1 158504350 critical splice donor site probably null
R8096:Astn1 UTSW 1 158609320 missense probably damaging 1.00
Z1088:Astn1 UTSW 1 158472497 missense possibly damaging 0.93
Z1088:Astn1 UTSW 1 158597206 missense possibly damaging 0.91
Z1088:Astn1 UTSW 1 158684096 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGTGAGTTGTGCCCAGAGAG -3'
(R):5'- CTGGGTTTTCAGCCTGGAAAG -3'

Sequencing Primer
(F):5'- TTGTGCCCAGAGAGAAGCAAAAAG -3'
(R):5'- TTCAGCCTGGAAAGTCCCTCAG -3'
Posted On2019-06-07