Incidental Mutation 'PIT4366001:Olfr1022'
ID554739
Institutional Source Beutler Lab
Gene Symbol Olfr1022
Ensembl Gene ENSMUSG00000057761
Gene Nameolfactory receptor 1022
SynonymsGA_x6K02T2Q125-47347069-47348016, MOR196-1
Accession Numbers

Ncbi RefSeq: NM_146589.2; MGI: 3030856

Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #PIT4366001 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location85868594-85869541 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85868882 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 97 (C97R)
Ref Sequence ENSEMBL: ENSMUSP00000059312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054736] [ENSMUST00000121914]
Predicted Effect probably damaging
Transcript: ENSMUST00000054736
AA Change: C97R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059312
Gene: ENSMUSG00000057761
AA Change: C97R

DomainStartEndE-ValueType
Pfam:7tm_4 31 312 4.8e-51 PFAM
Pfam:7TM_GPCR_Srsx 35 304 8e-6 PFAM
Pfam:7tm_1 41 290 9.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121914
Coding Region Coverage
  • 1x: 93.0%
  • 3x: 90.7%
  • 10x: 85.5%
  • 20x: 73.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C A 11: 120,010,960 S870I possibly damaging Het
Abca13 T C 11: 9,294,962 V2275A probably benign Het
Abcb5 T C 12: 118,936,098 K278R probably damaging Het
Adcy2 TA TAA 13: 68,709,990 probably benign Het
Add3 C T 19: 53,216,867 P16L unknown Het
Akap9 T A 5: 4,046,221 D2365E probably benign Het
Asah1 A G 8: 41,343,746 S300P possibly damaging Het
Astn1 A T 1: 158,597,209 H655L probably benign Het
Astn1 A T 1: 158,597,211 I656F probably benign Het
Bmpr1b T A 3: 141,880,463 T13S probably benign Het
Camsap2 A G 1: 136,280,317 F478L Het
Card10 G A 15: 78,787,431 S611L probably benign Het
Cep68 T C 11: 20,240,007 N335S probably benign Het
Chac1 T C 2: 119,351,505 W35R probably damaging Het
Cntn6 T C 6: 104,832,537 V511A probably benign Het
Cpne9 G T 6: 113,294,746 G356W probably damaging Het
Dnah10 C A 5: 124,775,524 T1939K possibly damaging Het
Dock10 T C 1: 80,595,721 N239D probably benign Het
Dock5 T C 14: 67,824,674 K415R possibly damaging Het
Dtd2 C A 12: 51,999,799 D86Y probably damaging Het
Efcab9 A G 11: 32,523,608 F127S probably damaging Het
Ermp1 T C 19: 29,628,789 H375R probably benign Het
Frem2 A T 3: 53,653,201 M1295K probably damaging Het
Gbp7 T G 3: 142,542,951 I325R probably benign Het
Gpr179 T C 11: 97,336,851 K1493E probably benign Het
Gucy2g T A 19: 55,237,782 E234V probably null Het
Itpr1 T A 6: 108,493,757 C2215* probably null Het
Ltn1 G A 16: 87,380,840 R1634* probably null Het
Lynx1 A T 15: 74,751,409 M58K possibly damaging Het
Macc1 T C 12: 119,446,949 V484A probably benign Het
Map3k9 C T 12: 81,772,761 V240M possibly damaging Het
Marc1 A G 1: 184,807,186 F96S probably benign Het
Mars A G 10: 127,299,398 M608T possibly damaging Het
Mc2r T C 18: 68,407,755 M156V probably benign Het
Mchr1 G T 15: 81,237,216 V56L probably benign Het
Mlxip C T 5: 123,395,110 P61S probably benign Het
Muc4 A G 16: 32,754,796 T1557A unknown Het
Myt1 T C 2: 181,825,938 V1135A probably damaging Het
Ndufaf6 A T 4: 11,073,215 S76T probably benign Het
Ntrk2 A G 13: 59,060,335 Y665C probably damaging Het
Oaz3 T G 3: 94,433,594 R215S unknown Het
Olfr1031 A T 2: 85,992,041 N75Y probably damaging Het
Olfr1133 C T 2: 87,645,190 W311* probably null Het
Olfr417 T C 1: 174,369,090 Y58H probably damaging Het
Perm1 G T 4: 156,218,735 V579L probably benign Het
Phyhipl A G 10: 70,568,958 V140A probably benign Het
Pip5k1c T A 10: 81,309,008 S228T probably damaging Het
Plekhn1 T G 4: 156,224,811 T213P probably damaging Het
Pomt2 A T 12: 87,116,529 probably null Het
Ptcd1 A G 5: 145,151,335 V622A probably benign Het
Ptn T A 6: 36,741,349 H127L probably benign Het
Ptprk A T 10: 28,586,019 M1193L probably benign Het
Ptpru G A 4: 131,799,712 P650S probably benign Het
Pum2 T A 12: 8,733,390 L613Q probably damaging Het
Rapgef6 A G 11: 54,691,620 T1458A probably damaging Het
Sap130 C T 18: 31,677,409 A470V probably benign Het
Sertad2 C A 11: 20,648,116 P104Q probably benign Het
Sfrp4 A T 13: 19,630,244 M324L unknown Het
Sh3bp4 A G 1: 89,145,434 N668S probably benign Het
Snx30 C A 4: 59,894,653 D410E probably benign Het
Spata31 C A 13: 64,921,505 S489* probably null Het
Taok3 T A 5: 117,227,985 M367K probably benign Het
Tfap2a T C 13: 40,721,374 N254D possibly damaging Het
Tgtp1 T G 11: 48,987,040 L279F possibly damaging Het
Tmpo A G 10: 91,163,310 F205S probably damaging Het
Tmprss5 A T 9: 49,112,217 I218L probably benign Het
Tti2 A G 8: 31,151,196 E116G probably benign Het
Vmn2r59 A T 7: 42,045,781 N402K possibly damaging Het
Other mutations in Olfr1022
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02701:Olfr1022 APN 2 85869458 missense probably benign 0.22
IGL03265:Olfr1022 APN 2 85869150 missense possibly damaging 0.80
R0057:Olfr1022 UTSW 2 85869253 nonsense probably null
R0057:Olfr1022 UTSW 2 85869253 nonsense probably null
R0554:Olfr1022 UTSW 2 85869519 missense probably benign 0.00
R3873:Olfr1022 UTSW 2 85868962 nonsense probably null
R3913:Olfr1022 UTSW 2 85868771 missense probably damaging 1.00
R4698:Olfr1022 UTSW 2 85869252 missense possibly damaging 0.90
R5628:Olfr1022 UTSW 2 85868805 missense probably damaging 0.99
R6467:Olfr1022 UTSW 2 85869370 nonsense probably null
R6947:Olfr1022 UTSW 2 85868927 missense probably benign 0.01
R7092:Olfr1022 UTSW 2 85868607 missense probably damaging 1.00
R7351:Olfr1022 UTSW 2 85864071 unclassified probably benign
R7574:Olfr1022 UTSW 2 85869006 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGAAACCTGTGTATGATTGTGC -3'
(R):5'- TTTCATGGGAGCCACAGAAAG -3'

Sequencing Primer
(F):5'- GTGCTGATCAGGACCAATTCC -3'
(R):5'- GAGTCTGAGACAGCCCATTCAG -3'
Posted On2019-06-07