Incidental Mutation 'PIT4366001:Oaz3'
ID554745
Institutional Source Beutler Lab
Gene Symbol Oaz3
Ensembl Gene ENSMUSG00000028141
Gene Nameornithine decarboxylase antizyme 3
SynonymsAZ-3, Oaz-t, antizyme 3, AZ3, ornithine decarboxylase antizyme in testis
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.240) question?
Stock #PIT4366001 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location94432414-94443915 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 94433594 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 215 (R215S)
Ref Sequence ENSEMBL: ENSMUSP00000139408 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045245] [ENSMUST00000166032] [ENSMUST00000191506] [ENSMUST00000196606] [ENSMUST00000197495] [ENSMUST00000197901] [ENSMUST00000199678] [ENSMUST00000203883] [ENSMUST00000204548] [ENSMUST00000204913]
Predicted Effect probably benign
Transcript: ENSMUST00000045245
SMART Domains Protein: ENSMUSP00000041002
Gene: ENSMUSG00000041912

DomainStartEndE-ValueType
transmembrane domain 17 34 N/A INTRINSIC
KH 51 120 9.32e-17 SMART
KH 123 195 3.93e-15 SMART
TUDOR 352 410 2.79e-6 SMART
low complexity region 429 434 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166032
SMART Domains Protein: ENSMUSP00000129635
Gene: ENSMUSG00000041912

DomainStartEndE-ValueType
transmembrane domain 17 34 N/A INTRINSIC
KH 51 120 9.32e-17 SMART
KH 123 195 3.93e-15 SMART
TUDOR 352 410 2.79e-6 SMART
low complexity region 429 434 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000191506
AA Change: R215S
SMART Domains Protein: ENSMUSP00000139408
Gene: ENSMUSG00000028141
AA Change: R215S

DomainStartEndE-ValueType
low complexity region 67 88 N/A INTRINSIC
Pfam:ODC_AZ 137 233 1.9e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196606
SMART Domains Protein: ENSMUSP00000143102
Gene: ENSMUSG00000041912

DomainStartEndE-ValueType
transmembrane domain 17 34 N/A INTRINSIC
KH 51 116 1.5e-11 SMART
KH 119 191 2.4e-17 SMART
TUDOR 348 406 1.7e-8 SMART
low complexity region 425 430 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197495
SMART Domains Protein: ENSMUSP00000143135
Gene: ENSMUSG00000041912

DomainStartEndE-ValueType
transmembrane domain 17 34 N/A INTRINSIC
KH 51 150 3e-18 SMART
TUDOR 307 365 1.7e-8 SMART
low complexity region 384 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197901
SMART Domains Protein: ENSMUSP00000142561
Gene: ENSMUSG00000041912

DomainStartEndE-ValueType
transmembrane domain 17 34 N/A INTRINSIC
KH 51 120 9.32e-17 SMART
KH 123 195 3.93e-15 SMART
TUDOR 352 410 2.79e-6 SMART
low complexity region 429 434 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199678
AA Change: R215S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143080
Gene: ENSMUSG00000028141
AA Change: R215S

DomainStartEndE-ValueType
low complexity region 23 41 N/A INTRINSIC
Pfam:ODC_AZ 90 186 1.3e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203883
AA Change: R170S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145484
Gene: ENSMUSG00000028141
AA Change: R170S

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Pfam:ODC_AZ 91 189 4.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204548
SMART Domains Protein: ENSMUSP00000145079
Gene: ENSMUSG00000028141

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204913
SMART Domains Protein: ENSMUSP00000145113
Gene: ENSMUSG00000028141

DomainStartEndE-ValueType
low complexity region 71 89 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204980
Coding Region Coverage
  • 1x: 93.0%
  • 3x: 90.7%
  • 10x: 85.5%
  • 20x: 73.8%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the ornithine decarboxylase antizyme family, which plays a role in cell growth and proliferation by regulating intracellular polyamine levels. Expression of antizymes requires +1 ribosomal frameshifting, which is enhanced by high levels of polyamines. Antizymes in turn bind to and inhibit ornithine decarboxylase (ODC), the key enzyme in polyamine biosynthesis; thus, completing the auto-regulatory circuit. This gene encodes antizyme 3, the third member of the antizyme family. Like antizymes 1 and 2, antizyme 3 inhibits ODC activity and polyamine uptake; however, it does not stimulate ODC degradation. Also, while antizymes 1 and 2 have broad tissue distribution, expression of antizyme 3 is restricted to haploid germ cells in testis, suggesting a distinct role for this antizyme in spermiogenesis. Antizyme 3 gene knockout studies showed that homozygous mutant male mice were infertile, and indicated the likely role of this antizyme in the formation of a rigid connection between the sperm head and tail during spermatogenesis. This transcript initiates translation from a non-AUG (CUG) codon that is highly conserved among the antizyme 3 orthologs. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit male infertility due to detachment of sperm tail and head during sperm maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C A 11: 120,010,960 S870I possibly damaging Het
Abca13 T C 11: 9,294,962 V2275A probably benign Het
Abcb5 T C 12: 118,936,098 K278R probably damaging Het
Adcy2 TA TAA 13: 68,709,990 probably benign Het
Add3 C T 19: 53,216,867 P16L unknown Het
Akap9 T A 5: 4,046,221 D2365E probably benign Het
Asah1 A G 8: 41,343,746 S300P possibly damaging Het
Astn1 A T 1: 158,597,209 H655L probably benign Het
Astn1 A T 1: 158,597,211 I656F probably benign Het
Bmpr1b T A 3: 141,880,463 T13S probably benign Het
Camsap2 A G 1: 136,280,317 F478L Het
Card10 G A 15: 78,787,431 S611L probably benign Het
Cep68 T C 11: 20,240,007 N335S probably benign Het
Chac1 T C 2: 119,351,505 W35R probably damaging Het
Cntn6 T C 6: 104,832,537 V511A probably benign Het
Cpne9 G T 6: 113,294,746 G356W probably damaging Het
Dnah10 C A 5: 124,775,524 T1939K possibly damaging Het
Dock10 T C 1: 80,595,721 N239D probably benign Het
Dock5 T C 14: 67,824,674 K415R possibly damaging Het
Dtd2 C A 12: 51,999,799 D86Y probably damaging Het
Efcab9 A G 11: 32,523,608 F127S probably damaging Het
Ermp1 T C 19: 29,628,789 H375R probably benign Het
Frem2 A T 3: 53,653,201 M1295K probably damaging Het
Gbp7 T G 3: 142,542,951 I325R probably benign Het
Gpr179 T C 11: 97,336,851 K1493E probably benign Het
Gucy2g T A 19: 55,237,782 E234V probably null Het
Itpr1 T A 6: 108,493,757 C2215* probably null Het
Ltn1 G A 16: 87,380,840 R1634* probably null Het
Lynx1 A T 15: 74,751,409 M58K possibly damaging Het
Macc1 T C 12: 119,446,949 V484A probably benign Het
Map3k9 C T 12: 81,772,761 V240M possibly damaging Het
Marc1 A G 1: 184,807,186 F96S probably benign Het
Mars A G 10: 127,299,398 M608T possibly damaging Het
Mc2r T C 18: 68,407,755 M156V probably benign Het
Mchr1 G T 15: 81,237,216 V56L probably benign Het
Mlxip C T 5: 123,395,110 P61S probably benign Het
Muc4 A G 16: 32,754,796 T1557A unknown Het
Myt1 T C 2: 181,825,938 V1135A probably damaging Het
Ndufaf6 A T 4: 11,073,215 S76T probably benign Het
Ntrk2 A G 13: 59,060,335 Y665C probably damaging Het
Olfr1022 T C 2: 85,868,882 C97R probably damaging Het
Olfr1031 A T 2: 85,992,041 N75Y probably damaging Het
Olfr1133 C T 2: 87,645,190 W311* probably null Het
Olfr417 T C 1: 174,369,090 Y58H probably damaging Het
Perm1 G T 4: 156,218,735 V579L probably benign Het
Phyhipl A G 10: 70,568,958 V140A probably benign Het
Pip5k1c T A 10: 81,309,008 S228T probably damaging Het
Plekhn1 T G 4: 156,224,811 T213P probably damaging Het
Pomt2 A T 12: 87,116,529 probably null Het
Ptcd1 A G 5: 145,151,335 V622A probably benign Het
Ptn T A 6: 36,741,349 H127L probably benign Het
Ptprk A T 10: 28,586,019 M1193L probably benign Het
Ptpru G A 4: 131,799,712 P650S probably benign Het
Pum2 T A 12: 8,733,390 L613Q probably damaging Het
Rapgef6 A G 11: 54,691,620 T1458A probably damaging Het
Sap130 C T 18: 31,677,409 A470V probably benign Het
Sertad2 C A 11: 20,648,116 P104Q probably benign Het
Sfrp4 A T 13: 19,630,244 M324L unknown Het
Sh3bp4 A G 1: 89,145,434 N668S probably benign Het
Snx30 C A 4: 59,894,653 D410E probably benign Het
Spata31 C A 13: 64,921,505 S489* probably null Het
Taok3 T A 5: 117,227,985 M367K probably benign Het
Tfap2a T C 13: 40,721,374 N254D possibly damaging Het
Tgtp1 T G 11: 48,987,040 L279F possibly damaging Het
Tmpo A G 10: 91,163,310 F205S probably damaging Het
Tmprss5 A T 9: 49,112,217 I218L probably benign Het
Tti2 A G 8: 31,151,196 E116G probably benign Het
Vmn2r59 A T 7: 42,045,781 N402K possibly damaging Het
Other mutations in Oaz3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02931:Oaz3 APN 3 94434980 missense probably benign 0.15
PIT4791001:Oaz3 UTSW 3 94433545 missense unknown
R1004:Oaz3 UTSW 3 94435043 missense probably damaging 1.00
R1833:Oaz3 UTSW 3 94436042 unclassified probably benign
R2230:Oaz3 UTSW 3 94434539 missense probably benign 0.21
R2231:Oaz3 UTSW 3 94434539 missense probably benign 0.21
R2232:Oaz3 UTSW 3 94434539 missense probably benign 0.21
R4487:Oaz3 UTSW 3 94435130 unclassified probably null
R4776:Oaz3 UTSW 3 94434998 missense probably benign 0.00
R5502:Oaz3 UTSW 3 94435085 missense probably damaging 1.00
R5930:Oaz3 UTSW 3 94436410 missense possibly damaging 0.89
R6212:Oaz3 UTSW 3 94435068 missense probably benign 0.23
R6362:Oaz3 UTSW 3 94434988 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAATCACATCCTGGGCCTC -3'
(R):5'- CTCTCAAAGAGTTTATATTCTGCTGG -3'

Sequencing Primer
(F):5'- CCTCAGAGTCCCGTGTGTTGAG -3'
(R):5'- AGCCCAGATGCTGCTTAACTG -3'
Posted On2019-06-07