Incidental Mutation 'PIT4366001:Bmpr1b'
ID554746
Institutional Source Beutler Lab
Gene Symbol Bmpr1b
Ensembl Gene ENSMUSG00000052430
Gene Namebone morphogenetic protein receptor, type 1B
SynonymsBMPR-IB, Alk6, Acvrlk6, CFK-43a
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.668) question?
Stock #PIT4366001 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location141837136-142169425 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 141880463 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 13 (T13S)
Ref Sequence ENSEMBL: ENSMUSP00000029948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029948] [ENSMUST00000098568] [ENSMUST00000106230] [ENSMUST00000106232] [ENSMUST00000131273]
PDB Structure Crystal structure of the GDF-5:BMP receptor IB complex. [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000029948
AA Change: T13S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029948
Gene: ENSMUSG00000052430
AA Change: T13S

DomainStartEndE-ValueType
Pfam:Activin_recp 30 110 2.6e-15 PFAM
transmembrane domain 127 149 N/A INTRINSIC
GS 174 204 4.58e-13 SMART
Blast:STYKc 210 491 1e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000098568
AA Change: T13S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000096167
Gene: ENSMUSG00000052430
AA Change: T13S

DomainStartEndE-ValueType
Pfam:Activin_recp 30 110 2.2e-15 PFAM
transmembrane domain 127 149 N/A INTRINSIC
GS 174 204 4.58e-13 SMART
Blast:STYKc 210 491 1e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106230
AA Change: T13S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101837
Gene: ENSMUSG00000052430
AA Change: T13S

DomainStartEndE-ValueType
Pfam:Activin_recp 30 110 2.6e-15 PFAM
transmembrane domain 127 149 N/A INTRINSIC
GS 174 204 4.58e-13 SMART
Blast:STYKc 210 491 1e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106232
AA Change: T13S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101839
Gene: ENSMUSG00000052430
AA Change: T13S

DomainStartEndE-ValueType
Pfam:Activin_recp 30 110 2.2e-15 PFAM
transmembrane domain 127 149 N/A INTRINSIC
GS 174 204 4.58e-13 SMART
Blast:STYKc 210 491 1e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000131273
AA Change: T13S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117478
Gene: ENSMUSG00000052430
AA Change: T13S

DomainStartEndE-ValueType
PDB:3EVS|C 13 47 1e-18 PDB
SCOP:d1es7b_ 28 47 2e-4 SMART
Coding Region Coverage
  • 1x: 93.0%
  • 3x: 90.7%
  • 10x: 85.5%
  • 20x: 73.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a serine/threonine kinase that functions as a receptor for bone morphogenetic proteins (BMPs). The encoded protein is a type I receptor, and forms a complex of two type II and two type I receptors at the cell membrane. This complex signals downstream to activate SMAD transcriptional regulators. This signaling is important in skeletal and bone development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mutantions of this gene affect the shape of the distal limb skeleton resulting in brachydactyly or failure to generate digit cartilage. Furthermore, inactivation results in female sterility due to abnormal oestrus cyclicity as well as retinal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C A 11: 120,010,960 S870I possibly damaging Het
Abca13 T C 11: 9,294,962 V2275A probably benign Het
Abcb5 T C 12: 118,936,098 K278R probably damaging Het
Adcy2 TA TAA 13: 68,709,990 probably benign Het
Add3 C T 19: 53,216,867 P16L unknown Het
Akap9 T A 5: 4,046,221 D2365E probably benign Het
Asah1 A G 8: 41,343,746 S300P possibly damaging Het
Astn1 A T 1: 158,597,209 H655L probably benign Het
Astn1 A T 1: 158,597,211 I656F probably benign Het
Camsap2 A G 1: 136,280,317 F478L Het
Card10 G A 15: 78,787,431 S611L probably benign Het
Cep68 T C 11: 20,240,007 N335S probably benign Het
Chac1 T C 2: 119,351,505 W35R probably damaging Het
Cntn6 T C 6: 104,832,537 V511A probably benign Het
Cpne9 G T 6: 113,294,746 G356W probably damaging Het
Dnah10 C A 5: 124,775,524 T1939K possibly damaging Het
Dock10 T C 1: 80,595,721 N239D probably benign Het
Dock5 T C 14: 67,824,674 K415R possibly damaging Het
Dtd2 C A 12: 51,999,799 D86Y probably damaging Het
Efcab9 A G 11: 32,523,608 F127S probably damaging Het
Ermp1 T C 19: 29,628,789 H375R probably benign Het
Frem2 A T 3: 53,653,201 M1295K probably damaging Het
Gbp7 T G 3: 142,542,951 I325R probably benign Het
Gpr179 T C 11: 97,336,851 K1493E probably benign Het
Gucy2g T A 19: 55,237,782 E234V probably null Het
Itpr1 T A 6: 108,493,757 C2215* probably null Het
Ltn1 G A 16: 87,380,840 R1634* probably null Het
Lynx1 A T 15: 74,751,409 M58K possibly damaging Het
Macc1 T C 12: 119,446,949 V484A probably benign Het
Map3k9 C T 12: 81,772,761 V240M possibly damaging Het
Marc1 A G 1: 184,807,186 F96S probably benign Het
Mars A G 10: 127,299,398 M608T possibly damaging Het
Mc2r T C 18: 68,407,755 M156V probably benign Het
Mchr1 G T 15: 81,237,216 V56L probably benign Het
Mlxip C T 5: 123,395,110 P61S probably benign Het
Muc4 A G 16: 32,754,796 T1557A unknown Het
Myt1 T C 2: 181,825,938 V1135A probably damaging Het
Ndufaf6 A T 4: 11,073,215 S76T probably benign Het
Ntrk2 A G 13: 59,060,335 Y665C probably damaging Het
Oaz3 T G 3: 94,433,594 R215S unknown Het
Olfr1022 T C 2: 85,868,882 C97R probably damaging Het
Olfr1031 A T 2: 85,992,041 N75Y probably damaging Het
Olfr1133 C T 2: 87,645,190 W311* probably null Het
Olfr417 T C 1: 174,369,090 Y58H probably damaging Het
Perm1 G T 4: 156,218,735 V579L probably benign Het
Phyhipl A G 10: 70,568,958 V140A probably benign Het
Pip5k1c T A 10: 81,309,008 S228T probably damaging Het
Plekhn1 T G 4: 156,224,811 T213P probably damaging Het
Pomt2 A T 12: 87,116,529 probably null Het
Ptcd1 A G 5: 145,151,335 V622A probably benign Het
Ptn T A 6: 36,741,349 H127L probably benign Het
Ptprk A T 10: 28,586,019 M1193L probably benign Het
Ptpru G A 4: 131,799,712 P650S probably benign Het
Pum2 T A 12: 8,733,390 L613Q probably damaging Het
Rapgef6 A G 11: 54,691,620 T1458A probably damaging Het
Sap130 C T 18: 31,677,409 A470V probably benign Het
Sertad2 C A 11: 20,648,116 P104Q probably benign Het
Sfrp4 A T 13: 19,630,244 M324L unknown Het
Sh3bp4 A G 1: 89,145,434 N668S probably benign Het
Snx30 C A 4: 59,894,653 D410E probably benign Het
Spata31 C A 13: 64,921,505 S489* probably null Het
Taok3 T A 5: 117,227,985 M367K probably benign Het
Tfap2a T C 13: 40,721,374 N254D possibly damaging Het
Tgtp1 T G 11: 48,987,040 L279F possibly damaging Het
Tmpo A G 10: 91,163,310 F205S probably damaging Het
Tmprss5 A T 9: 49,112,217 I218L probably benign Het
Tti2 A G 8: 31,151,196 E116G probably benign Het
Vmn2r59 A T 7: 42,045,781 N402K possibly damaging Het
Other mutations in Bmpr1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Bmpr1b APN 3 141871338 missense probably damaging 1.00
IGL01394:Bmpr1b APN 3 141862981 critical splice donor site probably null
IGL02078:Bmpr1b APN 3 141870737 missense possibly damaging 0.63
IGL02315:Bmpr1b APN 3 141857529 missense probably damaging 1.00
IGL02600:Bmpr1b APN 3 141840727 missense probably damaging 1.00
IGL02709:Bmpr1b APN 3 141856553 missense probably damaging 1.00
IGL02972:Bmpr1b APN 3 141870758 missense probably benign 0.00
IGL03305:Bmpr1b APN 3 141843024 splice site probably benign
R0026:Bmpr1b UTSW 3 141870733 missense probably benign 0.00
R0026:Bmpr1b UTSW 3 141870733 missense probably benign 0.00
R0242:Bmpr1b UTSW 3 141840676 missense probably damaging 1.00
R0242:Bmpr1b UTSW 3 141840676 missense probably damaging 1.00
R0463:Bmpr1b UTSW 3 141857430 missense possibly damaging 0.53
R0880:Bmpr1b UTSW 3 141870796 nonsense probably null
R1449:Bmpr1b UTSW 3 141871373 missense possibly damaging 0.79
R1815:Bmpr1b UTSW 3 141880363 missense probably benign 0.03
R1852:Bmpr1b UTSW 3 141857402 critical splice donor site probably null
R1971:Bmpr1b UTSW 3 141857572 missense probably damaging 1.00
R2064:Bmpr1b UTSW 3 141870807 missense probably benign 0.00
R2299:Bmpr1b UTSW 3 141845202 missense probably damaging 1.00
R2912:Bmpr1b UTSW 3 141880378 missense probably benign 0.00
R4899:Bmpr1b UTSW 3 141840683 missense probably damaging 1.00
R4960:Bmpr1b UTSW 3 141870785 missense probably damaging 1.00
R4970:Bmpr1b UTSW 3 141845187 missense probably damaging 1.00
R5331:Bmpr1b UTSW 3 141856415 missense probably damaging 1.00
R5607:Bmpr1b UTSW 3 141857522 missense possibly damaging 0.70
R5608:Bmpr1b UTSW 3 141857522 missense possibly damaging 0.70
R5829:Bmpr1b UTSW 3 141845157 missense probably benign 0.00
R5855:Bmpr1b UTSW 3 141871385 missense possibly damaging 0.76
R5933:Bmpr1b UTSW 3 141871367 makesense probably null
R6310:Bmpr1b UTSW 3 141864536 missense probably damaging 0.97
R6469:Bmpr1b UTSW 3 141856461 missense possibly damaging 0.95
R6826:Bmpr1b UTSW 3 141857406 missense probably damaging 1.00
R7167:Bmpr1b UTSW 3 141863080 missense probably benign 0.03
R7526:Bmpr1b UTSW 3 141856599 missense probably damaging 1.00
R8136:Bmpr1b UTSW 3 141856382 missense probably damaging 1.00
R8518:Bmpr1b UTSW 3 141857582 missense possibly damaging 0.95
Z1176:Bmpr1b UTSW 3 141842954 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TCTCCAGGTCATACTCTTGGAAAC -3'
(R):5'- TGCTCCATTATTTGACTGTGTGTAC -3'

Sequencing Primer
(F):5'- TGTTGACTGAGTCTTCCG -3'
(R):5'- TAAAGGCTGGAAGGCTGT -3'
Posted On2019-06-07