Incidental Mutation 'PIT4366001:Ptpru'
ID554750
Institutional Source Beutler Lab
Gene Symbol Ptpru
Ensembl Gene ENSMUSG00000028909
Gene Nameprotein tyrosine phosphatase, receptor type, U
SynonymsPtprl, RPTPlambda
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4366001 (G1)
Quality Score142.008
Status Not validated
Chromosome4
Chromosomal Location131768457-131838288 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 131799712 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 650 (P650S)
Ref Sequence ENSEMBL: ENSMUSP00000101607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030741] [ENSMUST00000097860] [ENSMUST00000105987]
Predicted Effect probably benign
Transcript: ENSMUST00000030741
AA Change: P650S

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000030741
Gene: ENSMUSG00000028909
AA Change: P650S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
MAM 22 188 5.58e-68 SMART
IG 195 283 4.93e-3 SMART
FN3 285 368 3.79e-2 SMART
FN3 384 472 2.5e-2 SMART
FN3 488 576 3.62e-8 SMART
low complexity region 627 641 N/A INTRINSIC
low complexity region 667 677 N/A INTRINSIC
transmembrane domain 747 769 N/A INTRINSIC
PTPc 893 1146 5.95e-102 SMART
PTPc 1175 1441 3.67e-93 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097860
AA Change: P578S

PolyPhen 2 Score 0.300 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000095472
Gene: ENSMUSG00000028909
AA Change: P578S

DomainStartEndE-ValueType
Pfam:MAM 1 116 4.1e-30 PFAM
IG 123 211 4.93e-3 SMART
FN3 213 296 3.79e-2 SMART
FN3 312 400 2.5e-2 SMART
FN3 416 504 3.62e-8 SMART
low complexity region 555 569 N/A INTRINSIC
low complexity region 595 605 N/A INTRINSIC
transmembrane domain 675 697 N/A INTRINSIC
Blast:PTPc 736 878 3e-49 BLAST
SCOP:d1jlna_ 790 886 9e-19 SMART
PDB:2C7S|A 797 878 7e-22 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000105987
AA Change: P650S

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000101607
Gene: ENSMUSG00000028909
AA Change: P650S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
MAM 22 188 5.58e-68 SMART
IG 195 283 4.93e-3 SMART
FN3 285 368 3.79e-2 SMART
FN3 384 472 2.5e-2 SMART
FN3 488 576 3.62e-8 SMART
low complexity region 627 641 N/A INTRINSIC
low complexity region 667 677 N/A INTRINSIC
transmembrane domain 748 770 N/A INTRINSIC
PTPc 883 1136 5.95e-102 SMART
PTPc 1165 1431 3.67e-93 SMART
Coding Region Coverage
  • 1x: 93.0%
  • 3x: 90.7%
  • 10x: 85.5%
  • 20x: 73.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. This PTP was thought to play roles in cell-cell recognition and adhesion. Studies of the similar gene in mice suggested the role of this PTP in early neural development. The expression of this gene was reported to be regulated by phorbol myristate acetate (PMA) or calcium ionophore in Jurkat T lymphoma cells. Alternatively spliced transcript variants have been reported. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C A 11: 120,010,960 S870I possibly damaging Het
Abca13 T C 11: 9,294,962 V2275A probably benign Het
Abcb5 T C 12: 118,936,098 K278R probably damaging Het
Adcy2 TA TAA 13: 68,709,990 probably benign Het
Add3 C T 19: 53,216,867 P16L unknown Het
Akap9 T A 5: 4,046,221 D2365E probably benign Het
Asah1 A G 8: 41,343,746 S300P possibly damaging Het
Astn1 A T 1: 158,597,209 H655L probably benign Het
Astn1 A T 1: 158,597,211 I656F probably benign Het
Bmpr1b T A 3: 141,880,463 T13S probably benign Het
Camsap2 A G 1: 136,280,317 F478L Het
Card10 G A 15: 78,787,431 S611L probably benign Het
Cep68 T C 11: 20,240,007 N335S probably benign Het
Chac1 T C 2: 119,351,505 W35R probably damaging Het
Cntn6 T C 6: 104,832,537 V511A probably benign Het
Cpne9 G T 6: 113,294,746 G356W probably damaging Het
Dnah10 C A 5: 124,775,524 T1939K possibly damaging Het
Dock10 T C 1: 80,595,721 N239D probably benign Het
Dock5 T C 14: 67,824,674 K415R possibly damaging Het
Dtd2 C A 12: 51,999,799 D86Y probably damaging Het
Efcab9 A G 11: 32,523,608 F127S probably damaging Het
Ermp1 T C 19: 29,628,789 H375R probably benign Het
Frem2 A T 3: 53,653,201 M1295K probably damaging Het
Gbp7 T G 3: 142,542,951 I325R probably benign Het
Gpr179 T C 11: 97,336,851 K1493E probably benign Het
Gucy2g T A 19: 55,237,782 E234V probably null Het
Itpr1 T A 6: 108,493,757 C2215* probably null Het
Ltn1 G A 16: 87,380,840 R1634* probably null Het
Lynx1 A T 15: 74,751,409 M58K possibly damaging Het
Macc1 T C 12: 119,446,949 V484A probably benign Het
Map3k9 C T 12: 81,772,761 V240M possibly damaging Het
Marc1 A G 1: 184,807,186 F96S probably benign Het
Mars A G 10: 127,299,398 M608T possibly damaging Het
Mc2r T C 18: 68,407,755 M156V probably benign Het
Mchr1 G T 15: 81,237,216 V56L probably benign Het
Mlxip C T 5: 123,395,110 P61S probably benign Het
Muc4 A G 16: 32,754,796 T1557A unknown Het
Myt1 T C 2: 181,825,938 V1135A probably damaging Het
Ndufaf6 A T 4: 11,073,215 S76T probably benign Het
Ntrk2 A G 13: 59,060,335 Y665C probably damaging Het
Oaz3 T G 3: 94,433,594 R215S unknown Het
Olfr1022 T C 2: 85,868,882 C97R probably damaging Het
Olfr1031 A T 2: 85,992,041 N75Y probably damaging Het
Olfr1133 C T 2: 87,645,190 W311* probably null Het
Olfr417 T C 1: 174,369,090 Y58H probably damaging Het
Perm1 G T 4: 156,218,735 V579L probably benign Het
Phyhipl A G 10: 70,568,958 V140A probably benign Het
Pip5k1c T A 10: 81,309,008 S228T probably damaging Het
Plekhn1 T G 4: 156,224,811 T213P probably damaging Het
Pomt2 A T 12: 87,116,529 probably null Het
Ptcd1 A G 5: 145,151,335 V622A probably benign Het
Ptn T A 6: 36,741,349 H127L probably benign Het
Ptprk A T 10: 28,586,019 M1193L probably benign Het
Pum2 T A 12: 8,733,390 L613Q probably damaging Het
Rapgef6 A G 11: 54,691,620 T1458A probably damaging Het
Sap130 C T 18: 31,677,409 A470V probably benign Het
Sertad2 C A 11: 20,648,116 P104Q probably benign Het
Sfrp4 A T 13: 19,630,244 M324L unknown Het
Sh3bp4 A G 1: 89,145,434 N668S probably benign Het
Snx30 C A 4: 59,894,653 D410E probably benign Het
Spata31 C A 13: 64,921,505 S489* probably null Het
Taok3 T A 5: 117,227,985 M367K probably benign Het
Tfap2a T C 13: 40,721,374 N254D possibly damaging Het
Tgtp1 T G 11: 48,987,040 L279F possibly damaging Het
Tmpo A G 10: 91,163,310 F205S probably damaging Het
Tmprss5 A T 9: 49,112,217 I218L probably benign Het
Tti2 A G 8: 31,151,196 E116G probably benign Het
Vmn2r59 A T 7: 42,045,781 N402K possibly damaging Het
Other mutations in Ptpru
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Ptpru APN 4 131808235 missense probably benign 0.00
IGL00966:Ptpru APN 4 131772616 missense probably damaging 1.00
IGL01451:Ptpru APN 4 131769492 utr 3 prime probably benign
IGL01453:Ptpru APN 4 131769492 utr 3 prime probably benign
IGL01606:Ptpru APN 4 131808481 missense possibly damaging 0.69
IGL02451:Ptpru APN 4 131776775 splice site probably benign
IGL03135:Ptpru APN 4 131818800 missense probably damaging 0.97
IGL03366:Ptpru APN 4 131779867 missense probably damaging 1.00
PIT4576001:Ptpru UTSW 4 131802544 nonsense probably null
R0299:Ptpru UTSW 4 131803387 nonsense probably null
R0458:Ptpru UTSW 4 131799675 missense possibly damaging 0.49
R0502:Ptpru UTSW 4 131793643 missense probably benign 0.02
R0503:Ptpru UTSW 4 131793643 missense probably benign 0.02
R0619:Ptpru UTSW 4 131820887 missense possibly damaging 0.91
R0639:Ptpru UTSW 4 131771179 missense possibly damaging 0.49
R0843:Ptpru UTSW 4 131797948 missense probably benign 0.10
R1065:Ptpru UTSW 4 131808340 missense possibly damaging 0.49
R1170:Ptpru UTSW 4 131808527 splice site probably benign
R1382:Ptpru UTSW 4 131808229 missense probably damaging 0.98
R1442:Ptpru UTSW 4 131808269 missense probably benign 0.00
R1538:Ptpru UTSW 4 131774351 missense probably damaging 0.99
R1624:Ptpru UTSW 4 131772550 missense probably damaging 1.00
R1688:Ptpru UTSW 4 131787345 missense probably benign 0.01
R1699:Ptpru UTSW 4 131779050 missense probably damaging 1.00
R1740:Ptpru UTSW 4 131793678 splice site probably null
R1874:Ptpru UTSW 4 131769755 missense probably benign
R1959:Ptpru UTSW 4 131803477 missense probably damaging 1.00
R2051:Ptpru UTSW 4 131819087 missense possibly damaging 0.80
R2200:Ptpru UTSW 4 131820813 missense probably damaging 1.00
R2281:Ptpru UTSW 4 131808499 missense probably damaging 1.00
R2304:Ptpru UTSW 4 131772568 missense probably damaging 1.00
R2411:Ptpru UTSW 4 131771469 missense probably damaging 1.00
R2845:Ptpru UTSW 4 131819661 missense probably benign 0.00
R3767:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3768:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3769:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3770:Ptpru UTSW 4 131808424 missense probably damaging 1.00
R3937:Ptpru UTSW 4 131774304 missense probably damaging 0.99
R4079:Ptpru UTSW 4 131798710 critical splice donor site probably null
R4110:Ptpru UTSW 4 131819037 missense probably damaging 1.00
R4170:Ptpru UTSW 4 131776348 missense probably damaging 1.00
R4716:Ptpru UTSW 4 131820968 missense probably benign
R4751:Ptpru UTSW 4 131802586 missense probably damaging 0.97
R4766:Ptpru UTSW 4 131820964 missense probably damaging 1.00
R4825:Ptpru UTSW 4 131799603 missense probably benign
R4900:Ptpru UTSW 4 131788382 missense probably damaging 0.99
R4998:Ptpru UTSW 4 131776885 missense probably damaging 1.00
R5279:Ptpru UTSW 4 131820023 missense possibly damaging 0.62
R5464:Ptpru UTSW 4 131772557 missense probably damaging 1.00
R5625:Ptpru UTSW 4 131803380 missense probably null 1.00
R5667:Ptpru UTSW 4 131820190 missense possibly damaging 0.94
R5671:Ptpru UTSW 4 131820190 missense possibly damaging 0.94
R5735:Ptpru UTSW 4 131838090 missense probably benign 0.01
R5802:Ptpru UTSW 4 131788377 missense possibly damaging 0.84
R5809:Ptpru UTSW 4 131785756 missense probably benign 0.34
R5953:Ptpru UTSW 4 131776837 missense probably damaging 1.00
R5973:Ptpru UTSW 4 131818925 missense probably benign 0.00
R6029:Ptpru UTSW 4 131771293 missense probably damaging 1.00
R6072:Ptpru UTSW 4 131776228 missense probably damaging 0.99
R6089:Ptpru UTSW 4 131772630 missense possibly damaging 0.94
R6174:Ptpru UTSW 4 131785754 missense probably benign
R6177:Ptpru UTSW 4 131793525 missense probably benign 0.00
R6367:Ptpru UTSW 4 131774352 missense probably benign 0.18
R6682:Ptpru UTSW 4 131820782 missense probably benign
R6950:Ptpru UTSW 4 131776352 missense probably damaging 0.99
R7159:Ptpru UTSW 4 131819540 missense probably damaging 1.00
R7736:Ptpru UTSW 4 131788382 missense probably damaging 1.00
R8094:Ptpru UTSW 4 131793592 missense possibly damaging 0.88
X0024:Ptpru UTSW 4 131771190 missense probably benign 0.15
Z1177:Ptpru UTSW 4 131799706 missense probably benign 0.00
Z1177:Ptpru UTSW 4 131808262 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGCTGCCTGGAAATAGATGAGATAG -3'
(R):5'- ATTTCTGTCCACACCCTGGG -3'

Sequencing Primer
(F):5'- CTGGAAATAGATGAGATAGGCCTTTC -3'
(R):5'- TCACTCCCATCTTGCAGAGGAG -3'
Posted On2019-06-07