Incidental Mutation 'PIT4366001:Plekhn1'
ID554752
Institutional Source Beutler Lab
Gene Symbol Plekhn1
Ensembl Gene ENSMUSG00000078485
Gene Namepleckstrin homology domain containing, family N member 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #PIT4366001 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location156221456-156234857 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 156224811 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 213 (T213P)
Ref Sequence ENSEMBL: ENSMUSP00000151311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105569] [ENSMUST00000105571] [ENSMUST00000105572] [ENSMUST00000217885] [ENSMUST00000218699]
Predicted Effect probably benign
Transcript: ENSMUST00000105569
SMART Domains Protein: ENSMUSP00000101194
Gene: ENSMUSG00000078485

DomainStartEndE-ValueType
low complexity region 20 50 N/A INTRINSIC
BTB 90 187 3.55e-30 SMART
BACK 192 294 1.08e-42 SMART
Kelch 341 387 4.01e-8 SMART
Kelch 388 434 5.41e-14 SMART
Kelch 435 481 6.97e-17 SMART
Kelch 482 528 1.55e-14 SMART
Kelch 529 575 2.02e-13 SMART
Kelch 576 622 1.34e-9 SMART
low complexity region 626 640 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105571
AA Change: T213P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101196
Gene: ENSMUSG00000078485
AA Change: T213P

DomainStartEndE-ValueType
PH 96 192 4.6e-4 SMART
PH 227 324 8.34e-2 SMART
low complexity region 346 359 N/A INTRINSIC
low complexity region 403 414 N/A INTRINSIC
low complexity region 499 527 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105572
SMART Domains Protein: ENSMUSP00000101197
Gene: ENSMUSG00000078486

DomainStartEndE-ValueType
low complexity region 40 58 N/A INTRINSIC
low complexity region 145 160 N/A INTRINSIC
low complexity region 441 452 N/A INTRINSIC
low complexity region 544 553 N/A INTRINSIC
low complexity region 606 616 N/A INTRINSIC
low complexity region 790 806 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000217885
AA Change: T213P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000218699
AA Change: T213P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Coding Region Coverage
  • 1x: 93.0%
  • 3x: 90.7%
  • 10x: 85.5%
  • 20x: 73.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C A 11: 120,010,960 S870I possibly damaging Het
Abca13 T C 11: 9,294,962 V2275A probably benign Het
Abcb5 T C 12: 118,936,098 K278R probably damaging Het
Adcy2 TA TAA 13: 68,709,990 probably benign Het
Add3 C T 19: 53,216,867 P16L unknown Het
Akap9 T A 5: 4,046,221 D2365E probably benign Het
Asah1 A G 8: 41,343,746 S300P possibly damaging Het
Astn1 A T 1: 158,597,209 H655L probably benign Het
Astn1 A T 1: 158,597,211 I656F probably benign Het
Bmpr1b T A 3: 141,880,463 T13S probably benign Het
Camsap2 A G 1: 136,280,317 F478L Het
Card10 G A 15: 78,787,431 S611L probably benign Het
Cep68 T C 11: 20,240,007 N335S probably benign Het
Chac1 T C 2: 119,351,505 W35R probably damaging Het
Cntn6 T C 6: 104,832,537 V511A probably benign Het
Cpne9 G T 6: 113,294,746 G356W probably damaging Het
Dnah10 C A 5: 124,775,524 T1939K possibly damaging Het
Dock10 T C 1: 80,595,721 N239D probably benign Het
Dock5 T C 14: 67,824,674 K415R possibly damaging Het
Dtd2 C A 12: 51,999,799 D86Y probably damaging Het
Efcab9 A G 11: 32,523,608 F127S probably damaging Het
Ermp1 T C 19: 29,628,789 H375R probably benign Het
Frem2 A T 3: 53,653,201 M1295K probably damaging Het
Gbp7 T G 3: 142,542,951 I325R probably benign Het
Gpr179 T C 11: 97,336,851 K1493E probably benign Het
Gucy2g T A 19: 55,237,782 E234V probably null Het
Itpr1 T A 6: 108,493,757 C2215* probably null Het
Ltn1 G A 16: 87,380,840 R1634* probably null Het
Lynx1 A T 15: 74,751,409 M58K possibly damaging Het
Macc1 T C 12: 119,446,949 V484A probably benign Het
Map3k9 C T 12: 81,772,761 V240M possibly damaging Het
Marc1 A G 1: 184,807,186 F96S probably benign Het
Mars A G 10: 127,299,398 M608T possibly damaging Het
Mc2r T C 18: 68,407,755 M156V probably benign Het
Mchr1 G T 15: 81,237,216 V56L probably benign Het
Mlxip C T 5: 123,395,110 P61S probably benign Het
Muc4 A G 16: 32,754,796 T1557A unknown Het
Myt1 T C 2: 181,825,938 V1135A probably damaging Het
Ndufaf6 A T 4: 11,073,215 S76T probably benign Het
Ntrk2 A G 13: 59,060,335 Y665C probably damaging Het
Oaz3 T G 3: 94,433,594 R215S unknown Het
Olfr1022 T C 2: 85,868,882 C97R probably damaging Het
Olfr1031 A T 2: 85,992,041 N75Y probably damaging Het
Olfr1133 C T 2: 87,645,190 W311* probably null Het
Olfr417 T C 1: 174,369,090 Y58H probably damaging Het
Perm1 G T 4: 156,218,735 V579L probably benign Het
Phyhipl A G 10: 70,568,958 V140A probably benign Het
Pip5k1c T A 10: 81,309,008 S228T probably damaging Het
Pomt2 A T 12: 87,116,529 probably null Het
Ptcd1 A G 5: 145,151,335 V622A probably benign Het
Ptn T A 6: 36,741,349 H127L probably benign Het
Ptprk A T 10: 28,586,019 M1193L probably benign Het
Ptpru G A 4: 131,799,712 P650S probably benign Het
Pum2 T A 12: 8,733,390 L613Q probably damaging Het
Rapgef6 A G 11: 54,691,620 T1458A probably damaging Het
Sap130 C T 18: 31,677,409 A470V probably benign Het
Sertad2 C A 11: 20,648,116 P104Q probably benign Het
Sfrp4 A T 13: 19,630,244 M324L unknown Het
Sh3bp4 A G 1: 89,145,434 N668S probably benign Het
Snx30 C A 4: 59,894,653 D410E probably benign Het
Spata31 C A 13: 64,921,505 S489* probably null Het
Taok3 T A 5: 117,227,985 M367K probably benign Het
Tfap2a T C 13: 40,721,374 N254D possibly damaging Het
Tgtp1 T G 11: 48,987,040 L279F possibly damaging Het
Tmpo A G 10: 91,163,310 F205S probably damaging Het
Tmprss5 A T 9: 49,112,217 I218L probably benign Het
Tti2 A G 8: 31,151,196 E116G probably benign Het
Vmn2r59 A T 7: 42,045,781 N402K possibly damaging Het
Other mutations in Plekhn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Plekhn1 APN 4 156223363 missense probably damaging 1.00
IGL00473:Plekhn1 APN 4 156223363 missense probably damaging 1.00
IGL02104:Plekhn1 APN 4 156222408 missense probably benign 0.25
IGL02122:Plekhn1 APN 4 156223856 critical splice donor site probably null
IGL02210:Plekhn1 APN 4 156223649 missense probably damaging 1.00
PIT4142001:Plekhn1 UTSW 4 156224940 nonsense probably null
R0123:Plekhn1 UTSW 4 156228243 missense probably benign 0.13
R0134:Plekhn1 UTSW 4 156228243 missense probably benign 0.13
R0225:Plekhn1 UTSW 4 156228243 missense probably benign 0.13
R0276:Plekhn1 UTSW 4 156228246 missense probably damaging 0.99
R0282:Plekhn1 UTSW 4 156228323 splice site probably benign
R0540:Plekhn1 UTSW 4 156222747 missense possibly damaging 0.87
R0569:Plekhn1 UTSW 4 156225201 missense probably damaging 1.00
R0656:Plekhn1 UTSW 4 156225364 missense possibly damaging 0.55
R0798:Plekhn1 UTSW 4 156228263 missense probably damaging 0.96
R0848:Plekhn1 UTSW 4 156223564 critical splice donor site probably null
R1803:Plekhn1 UTSW 4 156222381 missense probably benign 0.20
R2168:Plekhn1 UTSW 4 156221882 missense probably damaging 0.99
R2356:Plekhn1 UTSW 4 156222701 missense probably damaging 1.00
R2516:Plekhn1 UTSW 4 156222659 missense probably damaging 1.00
R3746:Plekhn1 UTSW 4 156225594 missense probably benign 0.00
R3818:Plekhn1 UTSW 4 156225533 missense probably damaging 1.00
R3902:Plekhn1 UTSW 4 156225669 missense possibly damaging 0.75
R4024:Plekhn1 UTSW 4 156224750 missense probably damaging 1.00
R4057:Plekhn1 UTSW 4 156224693 splice site probably null
R4176:Plekhn1 UTSW 4 156221801 missense probably benign 0.02
R4402:Plekhn1 UTSW 4 156225356 missense probably damaging 1.00
R4405:Plekhn1 UTSW 4 156225273 splice site probably null
R4477:Plekhn1 UTSW 4 156223399 missense probably damaging 1.00
R4515:Plekhn1 UTSW 4 156225531 missense probably damaging 1.00
R4517:Plekhn1 UTSW 4 156225531 missense probably damaging 1.00
R4518:Plekhn1 UTSW 4 156225531 missense probably damaging 1.00
R5086:Plekhn1 UTSW 4 156222424 missense probably benign 0.00
R5092:Plekhn1 UTSW 4 156224765 missense possibly damaging 0.93
R5201:Plekhn1 UTSW 4 156230527 missense probably benign 0.00
R5896:Plekhn1 UTSW 4 156223874 missense probably benign 0.02
R5913:Plekhn1 UTSW 4 156222695 missense probably damaging 1.00
R6124:Plekhn1 UTSW 4 156225239 missense possibly damaging 0.87
R6244:Plekhn1 UTSW 4 156230558 splice site probably null
R6263:Plekhn1 UTSW 4 156225193 critical splice donor site probably null
R6430:Plekhn1 UTSW 4 156221804 missense probably benign 0.00
R6703:Plekhn1 UTSW 4 156224793 missense probably benign 0.00
R6723:Plekhn1 UTSW 4 156224569 missense probably damaging 1.00
R6741:Plekhn1 UTSW 4 156221792 missense probably damaging 0.98
R7057:Plekhn1 UTSW 4 156233917 missense probably damaging 0.99
R7135:Plekhn1 UTSW 4 156223335 missense probably benign 0.04
R7347:Plekhn1 UTSW 4 156222671 missense probably benign 0.00
R7408:Plekhn1 UTSW 4 156233961 missense probably benign 0.14
R7423:Plekhn1 UTSW 4 156230685 missense probably benign 0.15
R7500:Plekhn1 UTSW 4 156233314 missense probably benign 0.19
R7613:Plekhn1 UTSW 4 156224820 missense probably benign 0.00
R7626:Plekhn1 UTSW 4 156225653 missense probably benign 0.00
R7738:Plekhn1 UTSW 4 156232234 missense probably damaging 1.00
R8065:Plekhn1 UTSW 4 156228240 missense possibly damaging 0.75
R8067:Plekhn1 UTSW 4 156228240 missense possibly damaging 0.75
R8744:Plekhn1 UTSW 4 156233907 missense probably damaging 1.00
R8746:Plekhn1 UTSW 4 156232225 missense probably damaging 1.00
R8841:Plekhn1 UTSW 4 156232198 missense probably damaging 0.98
X0023:Plekhn1 UTSW 4 156222354 missense possibly damaging 0.76
X0065:Plekhn1 UTSW 4 156224915 critical splice donor site probably null
Z1176:Plekhn1 UTSW 4 156223431 missense possibly damaging 0.47
Predicted Primers PCR Primer
(F):5'- TTCCTGTAAGGGGTCAAAGGG -3'
(R):5'- TGTTCTCTGCCACAGTGAGG -3'

Sequencing Primer
(F):5'- GCAGAGTAGGGTTGGGCAC -3'
(R):5'- ACAGTGAGGCCGAGCTCAG -3'
Posted On2019-06-07