Incidental Mutation 'PIT4366001:Tmpo'
ID554769
Institutional Source Beutler Lab
Gene Symbol Tmpo
Ensembl Gene ENSMUSG00000019961
Gene Namethymopoietin
Synonymslamina-associated polypeptide 2, TP, LAP2, 5630400D24Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4366001 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location91147571-91181315 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91163310 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 205 (F205S)
Ref Sequence ENSEMBL: ENSMUSP00000020123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020123] [ENSMUST00000072239] [ENSMUST00000092219] [ENSMUST00000099355] [ENSMUST00000105293]
PDB Structure THE DIMERIZATION DOMAIN OF LAP2ALPHA [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000020123
AA Change: F205S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000020123
Gene: ENSMUSG00000019961
AA Change: F205S

DomainStartEndE-ValueType
Thymopoietin 2 50 8.83e-30 SMART
low complexity region 78 91 N/A INTRINSIC
LEM 109 152 5.83e-21 SMART
low complexity region 189 197 N/A INTRINSIC
low complexity region 410 422 N/A INTRINSIC
Pfam:LAP2alpha 459 692 6.4e-155 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072239
SMART Domains Protein: ENSMUSP00000072092
Gene: ENSMUSG00000019961

DomainStartEndE-ValueType
Thymopoietin 2 50 8.83e-30 SMART
low complexity region 78 91 N/A INTRINSIC
LEM 109 152 5.83e-21 SMART
low complexity region 226 240 N/A INTRINSIC
transmembrane domain 410 429 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092219
SMART Domains Protein: ENSMUSP00000089864
Gene: ENSMUSG00000019961

DomainStartEndE-ValueType
Thymopoietin 2 50 8.83e-30 SMART
low complexity region 78 91 N/A INTRINSIC
LEM 109 152 5.83e-21 SMART
transmembrane domain 370 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099355
SMART Domains Protein: ENSMUSP00000096956
Gene: ENSMUSG00000019961

DomainStartEndE-ValueType
Thymopoietin 2 50 8.83e-30 SMART
low complexity region 78 91 N/A INTRINSIC
LEM 109 152 5.83e-21 SMART
transmembrane domain 338 357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105293
SMART Domains Protein: ENSMUSP00000100930
Gene: ENSMUSG00000019961

DomainStartEndE-ValueType
Thymopoietin 2 50 8.83e-30 SMART
low complexity region 78 91 N/A INTRINSIC
LEM 109 152 5.83e-21 SMART
transmembrane domain 301 320 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.0%
  • 3x: 90.7%
  • 10x: 85.5%
  • 20x: 73.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene resides in the nucleus and may play a role in the assembly of the nuclear lamina, and thus help maintain the structural organization of the nuclear envelope. It may function as a receptor for the attachment of lamin filaments to the inner nuclear membrane. Mutations in this gene are associated with dilated cardiomyopathy. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous null for a protein isoform generated from this locus have hyperproliferation of epidermal and erythroid progenitor cells that leads to thickened paws and increased crypt lengths in the colon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C A 11: 120,010,960 S870I possibly damaging Het
Abca13 T C 11: 9,294,962 V2275A probably benign Het
Abcb5 T C 12: 118,936,098 K278R probably damaging Het
Adcy2 TA TAA 13: 68,709,990 probably benign Het
Add3 C T 19: 53,216,867 P16L unknown Het
Akap9 T A 5: 4,046,221 D2365E probably benign Het
Asah1 A G 8: 41,343,746 S300P possibly damaging Het
Astn1 A T 1: 158,597,209 H655L probably benign Het
Astn1 A T 1: 158,597,211 I656F probably benign Het
Bmpr1b T A 3: 141,880,463 T13S probably benign Het
Camsap2 A G 1: 136,280,317 F478L Het
Card10 G A 15: 78,787,431 S611L probably benign Het
Cep68 T C 11: 20,240,007 N335S probably benign Het
Chac1 T C 2: 119,351,505 W35R probably damaging Het
Cntn6 T C 6: 104,832,537 V511A probably benign Het
Cpne9 G T 6: 113,294,746 G356W probably damaging Het
Dnah10 C A 5: 124,775,524 T1939K possibly damaging Het
Dock10 T C 1: 80,595,721 N239D probably benign Het
Dock5 T C 14: 67,824,674 K415R possibly damaging Het
Dtd2 C A 12: 51,999,799 D86Y probably damaging Het
Efcab9 A G 11: 32,523,608 F127S probably damaging Het
Ermp1 T C 19: 29,628,789 H375R probably benign Het
Frem2 A T 3: 53,653,201 M1295K probably damaging Het
Gbp7 T G 3: 142,542,951 I325R probably benign Het
Gpr179 T C 11: 97,336,851 K1493E probably benign Het
Gucy2g T A 19: 55,237,782 E234V probably null Het
Itpr1 T A 6: 108,493,757 C2215* probably null Het
Ltn1 G A 16: 87,380,840 R1634* probably null Het
Lynx1 A T 15: 74,751,409 M58K possibly damaging Het
Macc1 T C 12: 119,446,949 V484A probably benign Het
Map3k9 C T 12: 81,772,761 V240M possibly damaging Het
Marc1 A G 1: 184,807,186 F96S probably benign Het
Mars A G 10: 127,299,398 M608T possibly damaging Het
Mc2r T C 18: 68,407,755 M156V probably benign Het
Mchr1 G T 15: 81,237,216 V56L probably benign Het
Mlxip C T 5: 123,395,110 P61S probably benign Het
Muc4 A G 16: 32,754,796 T1557A unknown Het
Myt1 T C 2: 181,825,938 V1135A probably damaging Het
Ndufaf6 A T 4: 11,073,215 S76T probably benign Het
Ntrk2 A G 13: 59,060,335 Y665C probably damaging Het
Oaz3 T G 3: 94,433,594 R215S unknown Het
Olfr1022 T C 2: 85,868,882 C97R probably damaging Het
Olfr1031 A T 2: 85,992,041 N75Y probably damaging Het
Olfr1133 C T 2: 87,645,190 W311* probably null Het
Olfr417 T C 1: 174,369,090 Y58H probably damaging Het
Perm1 G T 4: 156,218,735 V579L probably benign Het
Phyhipl A G 10: 70,568,958 V140A probably benign Het
Pip5k1c T A 10: 81,309,008 S228T probably damaging Het
Plekhn1 T G 4: 156,224,811 T213P probably damaging Het
Pomt2 A T 12: 87,116,529 probably null Het
Ptcd1 A G 5: 145,151,335 V622A probably benign Het
Ptn T A 6: 36,741,349 H127L probably benign Het
Ptprk A T 10: 28,586,019 M1193L probably benign Het
Ptpru G A 4: 131,799,712 P650S probably benign Het
Pum2 T A 12: 8,733,390 L613Q probably damaging Het
Rapgef6 A G 11: 54,691,620 T1458A probably damaging Het
Sap130 C T 18: 31,677,409 A470V probably benign Het
Sertad2 C A 11: 20,648,116 P104Q probably benign Het
Sfrp4 A T 13: 19,630,244 M324L unknown Het
Sh3bp4 A G 1: 89,145,434 N668S probably benign Het
Snx30 C A 4: 59,894,653 D410E probably benign Het
Spata31 C A 13: 64,921,505 S489* probably null Het
Taok3 T A 5: 117,227,985 M367K probably benign Het
Tfap2a T C 13: 40,721,374 N254D possibly damaging Het
Tgtp1 T G 11: 48,987,040 L279F possibly damaging Het
Tmprss5 A T 9: 49,112,217 I218L probably benign Het
Tti2 A G 8: 31,151,196 E116G probably benign Het
Vmn2r59 A T 7: 42,045,781 N402K possibly damaging Het
Other mutations in Tmpo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00768:Tmpo APN 10 91164206 splice site probably benign
IGL00791:Tmpo APN 10 91162558 missense possibly damaging 0.94
IGL00919:Tmpo APN 10 91162800 missense probably damaging 0.99
IGL01382:Tmpo APN 10 91166050 missense probably damaging 1.00
IGL01806:Tmpo APN 10 91163242 missense probably benign 0.01
IGL01813:Tmpo APN 10 91163242 missense probably benign 0.01
IGL01838:Tmpo APN 10 91163242 missense probably benign 0.01
IGL01952:Tmpo APN 10 91163242 missense probably benign 0.01
IGL02110:Tmpo APN 10 91162865 missense probably damaging 1.00
IGL02122:Tmpo APN 10 91164136 missense possibly damaging 0.77
IGL02191:Tmpo APN 10 91161879 missense probably benign 0.00
IGL02338:Tmpo APN 10 91163242 missense probably benign 0.01
PIT4544001:Tmpo UTSW 10 91162114 missense probably benign
R0133:Tmpo UTSW 10 91164038 splice site probably benign
R0450:Tmpo UTSW 10 91163096 missense probably benign 0.45
R0469:Tmpo UTSW 10 91163096 missense probably benign 0.45
R0836:Tmpo UTSW 10 91161953 nonsense probably null
R2405:Tmpo UTSW 10 91163354 missense probably damaging 1.00
R2919:Tmpo UTSW 10 91152686 missense probably benign 0.23
R4059:Tmpo UTSW 10 91162261 missense probably benign 0.00
R4296:Tmpo UTSW 10 91162956 missense possibly damaging 0.49
R4741:Tmpo UTSW 10 91162644 missense probably benign 0.18
R4881:Tmpo UTSW 10 91162641 missense possibly damaging 0.93
R4915:Tmpo UTSW 10 91149549 missense probably damaging 1.00
R4917:Tmpo UTSW 10 91149549 missense probably damaging 1.00
R4960:Tmpo UTSW 10 91153309 missense probably damaging 1.00
R5002:Tmpo UTSW 10 91164114 missense possibly damaging 0.76
R5301:Tmpo UTSW 10 91149788 intron probably benign
R6167:Tmpo UTSW 10 91162938 missense probably benign
R6190:Tmpo UTSW 10 91164207 splice site probably null
R6979:Tmpo UTSW 10 91152497 splice site probably null
R7880:Tmpo UTSW 10 91166030 nonsense probably null
R8343:Tmpo UTSW 10 91162112 missense probably benign 0.00
R8492:Tmpo UTSW 10 91161858 missense probably benign 0.04
R8870:Tmpo UTSW 10 91151719 missense probably damaging 1.00
Z1177:Tmpo UTSW 10 91162860 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- GGAATAAATAAACTCCGTCCAGGG -3'
(R):5'- TGTATAGCAGATGAGTCGCTGAG -3'

Sequencing Primer
(F):5'- TCCAGGGGCTAACTTGTGC -3'
(R):5'- AGAGTGTGAAGTATAGGGCCCTTTTC -3'
Posted On2019-06-07