Mutagenetix > Incidental Mutations

Incidental Mutation 'PIT4366001:Rapgef6'

554776

Institutional Source

Beutler Lab

Gene Symbol

Rapgef6

Ensembl Gene

ENSMUSG00000037533

Gene Name

Rap guanine nucleotide exchange factor (GEF) 6

Synonyms

PDZ-GEF2, Pdzgef2, C030018K18Rik, RA-GEF-2

Accession Numbers

Genbank: NM_175258; MGI: 2384761

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

PIT4366001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

54522847-54699285 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 54691620 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 1458 (T1458A)

Ref Sequence

ENSEMBL: ENSMUSP00000147135 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094536] [ENSMUST00000101206] [ENSMUST00000102743] [ENSMUST00000108894] [ENSMUST00000207429]

Predicted Effect

probably benign
Transcript: ENSMUST00000094536

SMART Domains

Protein: ENSMUSP00000092114
Gene: ENSMUSG00000037533

Domain	Start	End	E-Value	Type
cNMP	1	113	6.64e-7	SMART
RasGEFN	127	240	4.35e-33	SMART
PDZ	255	327	8.86e-16	SMART
low complexity region	409	420	N/A	INTRINSIC
RA	464	550	1.47e-20	SMART
RasGEF	571	853	3.88e-84	SMART
low complexity region	944	957	N/A	INTRINSIC
low complexity region	972	989	N/A	INTRINSIC
low complexity region	1016	1061	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000101206
AA Change: T1461A

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000098766
Gene: ENSMUSG00000037533
AA Change: T1461A

Domain	Start	End	E-Value	Type
internal_repeat_1	10	82	1.45e-5	PROSPERO
low complexity region	187	205	N/A	INTRINSIC
low complexity region	231	239	N/A	INTRINSIC
cNMP	280	398	4.8e-13	SMART
RasGEFN	412	525	4.35e-33	SMART
PDZ	540	612	8.86e-16	SMART
low complexity region	694	705	N/A	INTRINSIC
RA	749	835	1.47e-20	SMART
RasGEF	856	1095	5.35e-87	SMART
low complexity region	1237	1250	N/A	INTRINSIC
low complexity region	1270	1293	N/A	INTRINSIC
low complexity region	1345	1364	N/A	INTRINSIC
low complexity region	1368	1380	N/A	INTRINSIC
low complexity region	1444	1452	N/A	INTRINSIC
low complexity region	1555	1568	N/A	INTRINSIC
low complexity region	1591	1604	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102743
AA Change: T1453A

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000099804
Gene: ENSMUSG00000037533
AA Change: T1453A

Domain	Start	End	E-Value	Type
internal_repeat_1	10	82	1.42e-5	PROSPERO
low complexity region	187	205	N/A	INTRINSIC
low complexity region	231	239	N/A	INTRINSIC
cNMP	280	398	4.8e-13	SMART
RasGEFN	412	525	4.35e-33	SMART
PDZ	540	612	8.86e-16	SMART
low complexity region	694	705	N/A	INTRINSIC
RA	749	835	1.47e-20	SMART
RasGEF	856	1138	3.88e-84	SMART
low complexity region	1229	1242	N/A	INTRINSIC
low complexity region	1262	1285	N/A	INTRINSIC
low complexity region	1337	1356	N/A	INTRINSIC
low complexity region	1360	1372	N/A	INTRINSIC
low complexity region	1436	1444	N/A	INTRINSIC
low complexity region	1547	1560	N/A	INTRINSIC
low complexity region	1583	1596	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000108894

SMART Domains

Protein: ENSMUSP00000104522
Gene: ENSMUSG00000037533

Domain	Start	End	E-Value	Type
cNMP	1	113	6.64e-7	SMART
RasGEFN	127	240	4.35e-33	SMART
PDZ	255	327	8.86e-16	SMART
low complexity region	409	420	N/A	INTRINSIC
RA	464	550	1.47e-20	SMART
RasGEF	571	810	5.35e-87	SMART
low complexity region	952	965	N/A	INTRINSIC
low complexity region	980	997	N/A	INTRINSIC
low complexity region	1024	1069	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000114574
Gene: ENSMUSG00000037533
AA Change: T63A

Domain	Start	End	E-Value	Type
low complexity region	47	55	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000207429
AA Change: T1458A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

Coding Region Coverage

1x: 93.0%
3x: 90.7%
10x: 85.5%
20x: 73.8%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit an inlarged spleen, increased IgE and IgG levels and altered cytokine production. [provided by MGI curators]

Allele List at MGI

All alleles(16) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(13)

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	C	A	11: 120,010,960	S870I	possibly damaging	Het
Abca13	T	C	11: 9,294,962	V2275A	probably benign	Het
Abcb5	T	C	12: 118,936,098	K278R	probably damaging	Het
Adcy2	TA	TAA	13: 68,709,990		probably benign	Het
Add3	C	T	19: 53,216,867	P16L	unknown	Het
Akap9	T	A	5: 4,046,221	D2365E	probably benign	Het
Asah1	A	G	8: 41,343,746	S300P	possibly damaging	Het
Astn1	A	T	1: 158,597,209	H655L	probably benign	Het
Astn1	A	T	1: 158,597,211	I656F	probably benign	Het
Bmpr1b	T	A	3: 141,880,463	T13S	probably benign	Het
Camsap2	A	G	1: 136,280,317	F478L		Het
Card10	G	A	15: 78,787,431	S611L	probably benign	Het
Cep68	T	C	11: 20,240,007	N335S	probably benign	Het
Chac1	T	C	2: 119,351,505	W35R	probably damaging	Het
Cntn6	T	C	6: 104,832,537	V511A	probably benign	Het
Cpne9	G	T	6: 113,294,746	G356W	probably damaging	Het
Dnah10	C	A	5: 124,775,524	T1939K	possibly damaging	Het
Dock10	T	C	1: 80,595,721	N239D	probably benign	Het
Dock5	T	C	14: 67,824,674	K415R	possibly damaging	Het
Dtd2	C	A	12: 51,999,799	D86Y	probably damaging	Het
Efcab9	A	G	11: 32,523,608	F127S	probably damaging	Het
Ermp1	T	C	19: 29,628,789	H375R	probably benign	Het
Frem2	A	T	3: 53,653,201	M1295K	probably damaging	Het
Gbp7	T	G	3: 142,542,951	I325R	probably benign	Het
Gpr179	T	C	11: 97,336,851	K1493E	probably benign	Het
Gucy2g	T	A	19: 55,237,782	E234V	probably null	Het
Itpr1	T	A	6: 108,493,757	C2215*	probably null	Het
Ltn1	G	A	16: 87,380,840	R1634*	probably null	Het
Lynx1	A	T	15: 74,751,409	M58K	possibly damaging	Het
Macc1	T	C	12: 119,446,949	V484A	probably benign	Het
Map3k9	C	T	12: 81,772,761	V240M	possibly damaging	Het
Marc1	A	G	1: 184,807,186	F96S	probably benign	Het
Mars	A	G	10: 127,299,398	M608T	possibly damaging	Het
Mc2r	T	C	18: 68,407,755	M156V	probably benign	Het
Mchr1	G	T	15: 81,237,216	V56L	probably benign	Het
Mlxip	C	T	5: 123,395,110	P61S	probably benign	Het
Muc4	A	G	16: 32,754,796	T1557A	unknown	Het
Myt1	T	C	2: 181,825,938	V1135A	probably damaging	Het
Ndufaf6	A	T	4: 11,073,215	S76T	probably benign	Het
Ntrk2	A	G	13: 59,060,335	Y665C	probably damaging	Het
Oaz3	T	G	3: 94,433,594	R215S	unknown	Het
Olfr1022	T	C	2: 85,868,882	C97R	probably damaging	Het
Olfr1031	A	T	2: 85,992,041	N75Y	probably damaging	Het
Olfr1133	C	T	2: 87,645,190	W311*	probably null	Het
Olfr417	T	C	1: 174,369,090	Y58H	probably damaging	Het
Perm1	G	T	4: 156,218,735	V579L	probably benign	Het
Phyhipl	A	G	10: 70,568,958	V140A	probably benign	Het
Pip5k1c	T	A	10: 81,309,008	S228T	probably damaging	Het
Plekhn1	T	G	4: 156,224,811	T213P	probably damaging	Het
Pomt2	A	T	12: 87,116,529		probably null	Het
Ptcd1	A	G	5: 145,151,335	V622A	probably benign	Het
Ptn	T	A	6: 36,741,349	H127L	probably benign	Het
Ptprk	A	T	10: 28,586,019	M1193L	probably benign	Het
Ptpru	G	A	4: 131,799,712	P650S	probably benign	Het
Pum2	T	A	12: 8,733,390	L613Q	probably damaging	Het
Sap130	C	T	18: 31,677,409	A470V	probably benign	Het
Sertad2	C	A	11: 20,648,116	P104Q	probably benign	Het
Sfrp4	A	T	13: 19,630,244	M324L	unknown	Het
Sh3bp4	A	G	1: 89,145,434	N668S	probably benign	Het
Snx30	C	A	4: 59,894,653	D410E	probably benign	Het
Spata31	C	A	13: 64,921,505	S489*	probably null	Het
Taok3	T	A	5: 117,227,985	M367K	probably benign	Het
Tfap2a	T	C	13: 40,721,374	N254D	possibly damaging	Het
Tgtp1	T	G	11: 48,987,040	L279F	possibly damaging	Het
Tmpo	A	G	10: 91,163,310	F205S	probably damaging	Het
Tmprss5	A	T	9: 49,112,217	I218L	probably benign	Het
Tti2	A	G	8: 31,151,196	E116G	probably benign	Het
Vmn2r59	A	T	7: 42,045,781	N402K	possibly damaging	Het

Other mutations in Rapgef6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00436:Rapgef6	APN	11	54679265	missense	probably benign	0.00
IGL00507:Rapgef6	APN	11	54664109	nonsense	probably null
IGL00809:Rapgef6	APN	11	54649300	missense	probably damaging	1.00
IGL00843:Rapgef6	APN	11	54691273	missense	probably benign	0.03
IGL00899:Rapgef6	APN	11	54620018	nonsense	probably null
IGL01372:Rapgef6	APN	11	54668611	splice site	probably benign
IGL01604:Rapgef6	APN	11	54694563	missense	probably damaging	0.99
IGL01935:Rapgef6	APN	11	54610842	missense	possibly damaging	0.78
IGL01991:Rapgef6	APN	11	54552869	missense	probably benign	0.37
IGL02243:Rapgef6	APN	11	54676400	missense	probably damaging	1.00
IGL02407:Rapgef6	APN	11	54676355	missense	possibly damaging	0.91
IGL02676:Rapgef6	APN	11	54649346	unclassified	probably benign
IGL02934:Rapgef6	APN	11	54625864	missense	probably damaging	1.00
IGL03076:Rapgef6	APN	11	54625967	missense	probably damaging	1.00
IGL03110:Rapgef6	APN	11	54696089	missense	probably damaging	0.97
IGL03256:Rapgef6	APN	11	54657429	missense	probably damaging	1.00
shocker	UTSW	11	54620016	missense	probably damaging	1.00
D4216:Rapgef6	UTSW	11	54668746	splice site	probably benign
PIT4305001:Rapgef6	UTSW	11	54679377	missense	probably damaging	1.00
R0047:Rapgef6	UTSW	11	54546378	missense	possibly damaging	0.65
R0047:Rapgef6	UTSW	11	54546378	missense	possibly damaging	0.65
R0125:Rapgef6	UTSW	11	54625875	nonsense	probably null
R0189:Rapgef6	UTSW	11	54691249	missense	probably benign
R0201:Rapgef6	UTSW	11	54619941	missense	probably damaging	1.00
R0505:Rapgef6	UTSW	11	54625963	missense	probably benign	0.00
R0524:Rapgef6	UTSW	11	54690284	missense	probably benign	0.32
R0853:Rapgef6	UTSW	11	54668677	missense	probably damaging	1.00
R1203:Rapgef6	UTSW	11	54691699	missense	probably benign	0.09
R1440:Rapgef6	UTSW	11	54626708	missense	probably damaging	1.00
R1453:Rapgef6	UTSW	11	54639727	intron	probably null
R1530:Rapgef6	UTSW	11	54661183	missense	probably damaging	1.00
R1593:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1620:Rapgef6	UTSW	11	54626594	missense	possibly damaging	0.88
R1628:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1629:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1630:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1634:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1640:Rapgef6	UTSW	11	54657405	missense	probably damaging	1.00
R1686:Rapgef6	UTSW	11	54691632	missense	possibly damaging	0.81
R1722:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1743:Rapgef6	UTSW	11	54676284	missense	probably damaging	1.00
R1816:Rapgef6	UTSW	11	54694488	missense	probably benign
R1851:Rapgef6	UTSW	11	54642811	missense	probably benign	0.01
R1852:Rapgef6	UTSW	11	54642811	missense	probably benign	0.01
R1868:Rapgef6	UTSW	11	54546397	frame shift	probably null
R1888:Rapgef6	UTSW	11	54660828	missense	probably damaging	1.00
R1888:Rapgef6	UTSW	11	54660828	missense	probably damaging	1.00
R1942:Rapgef6	UTSW	11	54657263	missense	possibly damaging	0.95
R1943:Rapgef6	UTSW	11	54657263	missense	possibly damaging	0.95
R2031:Rapgef6	UTSW	11	54552858	missense	probably benign	0.30
R2087:Rapgef6	UTSW	11	54631249	missense	probably damaging	1.00
R2106:Rapgef6	UTSW	11	54668686	missense	probably benign	0.17
R2362:Rapgef6	UTSW	11	54694272	missense	probably damaging	1.00
R2484:Rapgef6	UTSW	11	54642756	missense	possibly damaging	0.48
R2566:Rapgef6	UTSW	11	54687711	missense	possibly damaging	0.66
R2872:Rapgef6	UTSW	11	54661175	missense	probably damaging	1.00
R2872:Rapgef6	UTSW	11	54661175	missense	probably damaging	1.00
R3744:Rapgef6	UTSW	11	54625934	missense	probably benign	0.40
R3848:Rapgef6	UTSW	11	54691308	missense	probably damaging	0.97
R4823:Rapgef6	UTSW	11	54694500	missense	probably benign	0.08
R4859:Rapgef6	UTSW	11	54636163	missense	probably benign
R4906:Rapgef6	UTSW	11	54552836	missense	probably damaging	1.00
R4911:Rapgef6	UTSW	11	54622317	missense	probably damaging	0.97
R4937:Rapgef6	UTSW	11	54657317	missense	probably damaging	1.00
R5033:Rapgef6	UTSW	11	54691381	missense	possibly damaging	0.92
R5249:Rapgef6	UTSW	11	54523117	missense	probably benign	0.19
R5304:Rapgef6	UTSW	11	54657374	missense	probably benign	0.01
R5656:Rapgef6	UTSW	11	54636136	missense	possibly damaging	0.95
R5701:Rapgef6	UTSW	11	54676394	missense	possibly damaging	0.76
R5758:Rapgef6	UTSW	11	54668644	missense	probably damaging	1.00
R5973:Rapgef6	UTSW	11	54639783	missense	probably damaging	1.00
R6177:Rapgef6	UTSW	11	54620016	missense	probably damaging	1.00
R6268:Rapgef6	UTSW	11	54649247	missense	probably damaging	1.00
R6287:Rapgef6	UTSW	11	54626338	intron	probably null
R6293:Rapgef6	UTSW	11	54634781	missense	probably damaging	1.00
R6471:Rapgef6	UTSW	11	54691737	missense	probably damaging	0.99
R6863:Rapgef6	UTSW	11	54546380	missense	probably benign	0.00
R6950:Rapgef6	UTSW	11	54676380	missense	probably benign	0.09
R7144:Rapgef6	UTSW	11	54657365	missense	possibly damaging	0.78
R7171:Rapgef6	UTSW	11	54676363	missense	possibly damaging	0.94
R7199:Rapgef6	UTSW	11	54546426	missense	probably benign	0.00
R7291:Rapgef6	UTSW	11	54691239	missense	probably benign	0.05
R7436:Rapgef6	UTSW	11	54610921	critical splice donor site	probably null
R7498:Rapgef6	UTSW	11	54620004	missense	probably damaging	1.00
R7506:Rapgef6	UTSW	11	54636171	missense	probably benign	0.00
R7527:Rapgef6	UTSW	11	54634961	missense	unknown
R7646:Rapgef6	UTSW	11	54625954	missense	probably benign	0.00
R7655:Rapgef6	UTSW	11	54694453	missense	probably benign	0.10
R7656:Rapgef6	UTSW	11	54694453	missense	probably benign	0.10
R7687:Rapgef6	UTSW	11	54661075	missense	possibly damaging	0.93
R7768:Rapgef6	UTSW	11	54626588	missense	probably damaging	1.00
R7788:Rapgef6	UTSW	11	54694399	missense	probably damaging	1.00
R7890:Rapgef6	UTSW	11	54626723	missense	probably damaging	1.00
R7973:Rapgef6	UTSW	11	54626723	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCTGGGACTTCCTGAATTC -3'
(R):5'- GATAGCCCCGTATCTCTTTCTAGG -3'

Sequencing Primer
(F):5'- GGGACTTCCTGAATTCTTACAGACAC -3'
(R):5'- CCCGTATCTCTTTCTAGGGGGAG -3'

Posted On

2019-06-07