Incidental Mutation 'PIT4366001:Map3k9'
ID554781
Institutional Source Beutler Lab
Gene Symbol Map3k9
Ensembl Gene ENSMUSG00000042724
Gene Namemitogen-activated protein kinase kinase kinase 9
SynonymsMlk1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4366001 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location81721010-81781175 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 81772761 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 240 (V240M)
Ref Sequence ENSEMBL: ENSMUSP00000041819 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035987] [ENSMUST00000222322]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035987
AA Change: V240M

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000041819
Gene: ENSMUSG00000042724
AA Change: V240M

DomainStartEndE-ValueType
low complexity region 14 40 N/A INTRINSIC
SH3 48 108 1.61e-20 SMART
TyrKc 137 396 6.72e-89 SMART
low complexity region 449 469 N/A INTRINSIC
low complexity region 573 590 N/A INTRINSIC
low complexity region 644 657 N/A INTRINSIC
low complexity region 722 736 N/A INTRINSIC
low complexity region 749 765 N/A INTRINSIC
low complexity region 772 783 N/A INTRINSIC
low complexity region 799 811 N/A INTRINSIC
low complexity region 901 915 N/A INTRINSIC
low complexity region 1020 1036 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000222322
AA Change: V240M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 93.0%
  • 3x: 90.7%
  • 10x: 85.5%
  • 20x: 73.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a reporter/null allele exhibit normal development, reproduction and lifespan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C A 11: 120,010,960 S870I possibly damaging Het
Abca13 T C 11: 9,294,962 V2275A probably benign Het
Abcb5 T C 12: 118,936,098 K278R probably damaging Het
Adcy2 TA TAA 13: 68,709,990 probably benign Het
Add3 C T 19: 53,216,867 P16L unknown Het
Akap9 T A 5: 4,046,221 D2365E probably benign Het
Asah1 A G 8: 41,343,746 S300P possibly damaging Het
Astn1 A T 1: 158,597,209 H655L probably benign Het
Astn1 A T 1: 158,597,211 I656F probably benign Het
Bmpr1b T A 3: 141,880,463 T13S probably benign Het
Camsap2 A G 1: 136,280,317 F478L Het
Card10 G A 15: 78,787,431 S611L probably benign Het
Cep68 T C 11: 20,240,007 N335S probably benign Het
Chac1 T C 2: 119,351,505 W35R probably damaging Het
Cntn6 T C 6: 104,832,537 V511A probably benign Het
Cpne9 G T 6: 113,294,746 G356W probably damaging Het
Dnah10 C A 5: 124,775,524 T1939K possibly damaging Het
Dock10 T C 1: 80,595,721 N239D probably benign Het
Dock5 T C 14: 67,824,674 K415R possibly damaging Het
Dtd2 C A 12: 51,999,799 D86Y probably damaging Het
Efcab9 A G 11: 32,523,608 F127S probably damaging Het
Ermp1 T C 19: 29,628,789 H375R probably benign Het
Frem2 A T 3: 53,653,201 M1295K probably damaging Het
Gbp7 T G 3: 142,542,951 I325R probably benign Het
Gpr179 T C 11: 97,336,851 K1493E probably benign Het
Gucy2g T A 19: 55,237,782 E234V probably null Het
Itpr1 T A 6: 108,493,757 C2215* probably null Het
Ltn1 G A 16: 87,380,840 R1634* probably null Het
Lynx1 A T 15: 74,751,409 M58K possibly damaging Het
Macc1 T C 12: 119,446,949 V484A probably benign Het
Marc1 A G 1: 184,807,186 F96S probably benign Het
Mars A G 10: 127,299,398 M608T possibly damaging Het
Mc2r T C 18: 68,407,755 M156V probably benign Het
Mchr1 G T 15: 81,237,216 V56L probably benign Het
Mlxip C T 5: 123,395,110 P61S probably benign Het
Muc4 A G 16: 32,754,796 T1557A unknown Het
Myt1 T C 2: 181,825,938 V1135A probably damaging Het
Ndufaf6 A T 4: 11,073,215 S76T probably benign Het
Ntrk2 A G 13: 59,060,335 Y665C probably damaging Het
Oaz3 T G 3: 94,433,594 R215S unknown Het
Olfr1022 T C 2: 85,868,882 C97R probably damaging Het
Olfr1031 A T 2: 85,992,041 N75Y probably damaging Het
Olfr1133 C T 2: 87,645,190 W311* probably null Het
Olfr417 T C 1: 174,369,090 Y58H probably damaging Het
Perm1 G T 4: 156,218,735 V579L probably benign Het
Phyhipl A G 10: 70,568,958 V140A probably benign Het
Pip5k1c T A 10: 81,309,008 S228T probably damaging Het
Plekhn1 T G 4: 156,224,811 T213P probably damaging Het
Pomt2 A T 12: 87,116,529 probably null Het
Ptcd1 A G 5: 145,151,335 V622A probably benign Het
Ptn T A 6: 36,741,349 H127L probably benign Het
Ptprk A T 10: 28,586,019 M1193L probably benign Het
Ptpru G A 4: 131,799,712 P650S probably benign Het
Pum2 T A 12: 8,733,390 L613Q probably damaging Het
Rapgef6 A G 11: 54,691,620 T1458A probably damaging Het
Sap130 C T 18: 31,677,409 A470V probably benign Het
Sertad2 C A 11: 20,648,116 P104Q probably benign Het
Sfrp4 A T 13: 19,630,244 M324L unknown Het
Sh3bp4 A G 1: 89,145,434 N668S probably benign Het
Snx30 C A 4: 59,894,653 D410E probably benign Het
Spata31 C A 13: 64,921,505 S489* probably null Het
Taok3 T A 5: 117,227,985 M367K probably benign Het
Tfap2a T C 13: 40,721,374 N254D possibly damaging Het
Tgtp1 T G 11: 48,987,040 L279F possibly damaging Het
Tmpo A G 10: 91,163,310 F205S probably damaging Het
Tmprss5 A T 9: 49,112,217 I218L probably benign Het
Tti2 A G 8: 31,151,196 E116G probably benign Het
Vmn2r59 A T 7: 42,045,781 N402K possibly damaging Het
Other mutations in Map3k9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00640:Map3k9 APN 12 81729698 missense probably benign 0.00
IGL01098:Map3k9 APN 12 81724154 missense probably damaging 1.00
IGL01122:Map3k9 APN 12 81732126 missense possibly damaging 0.94
IGL01680:Map3k9 APN 12 81724739 missense probably benign 0.10
IGL01997:Map3k9 APN 12 81772697 missense probably damaging 1.00
IGL02178:Map3k9 APN 12 81743837 missense probably damaging 1.00
IGL02724:Map3k9 APN 12 81724742 missense probably benign
R0530:Map3k9 UTSW 12 81722482 missense probably benign 0.00
R0541:Map3k9 UTSW 12 81734223 missense possibly damaging 0.79
R0550:Map3k9 UTSW 12 81725781 missense probably damaging 1.00
R0799:Map3k9 UTSW 12 81722269 missense probably benign 0.27
R1730:Map3k9 UTSW 12 81722226 missense probably damaging 0.99
R1783:Map3k9 UTSW 12 81722226 missense probably damaging 0.99
R1859:Map3k9 UTSW 12 81724482 missense possibly damaging 0.82
R1917:Map3k9 UTSW 12 81780790 nonsense probably null
R3121:Map3k9 UTSW 12 81743924 missense probably damaging 1.00
R3779:Map3k9 UTSW 12 81743791 splice site probably benign
R3931:Map3k9 UTSW 12 81772917 missense probably damaging 0.99
R3951:Map3k9 UTSW 12 81722521 missense probably benign
R4571:Map3k9 UTSW 12 81734091 missense probably benign 0.25
R4728:Map3k9 UTSW 12 81722373 missense probably damaging 0.96
R4857:Map3k9 UTSW 12 81724627 missense probably benign 0.42
R4882:Map3k9 UTSW 12 81724162 missense probably damaging 1.00
R5077:Map3k9 UTSW 12 81734077 splice site probably null
R5369:Map3k9 UTSW 12 81722052 missense probably damaging 0.98
R5418:Map3k9 UTSW 12 81743817 nonsense probably null
R5540:Map3k9 UTSW 12 81772813 missense probably damaging 1.00
R5567:Map3k9 UTSW 12 81732024 missense possibly damaging 0.67
R5570:Map3k9 UTSW 12 81732024 missense possibly damaging 0.67
R5696:Map3k9 UTSW 12 81734122 missense probably benign 0.00
R6539:Map3k9 UTSW 12 81732192 missense probably damaging 0.98
R6542:Map3k9 UTSW 12 81722254 missense possibly damaging 0.91
R6816:Map3k9 UTSW 12 81722254 missense possibly damaging 0.91
R6964:Map3k9 UTSW 12 81773003 missense probably benign 0.00
R7027:Map3k9 UTSW 12 81730624 missense probably benign 0.06
R7055:Map3k9 UTSW 12 81724208 missense probably damaging 0.99
R7082:Map3k9 UTSW 12 81724702 missense probably damaging 1.00
R7247:Map3k9 UTSW 12 81725830 missense possibly damaging 0.65
R7424:Map3k9 UTSW 12 81724097 missense probably benign 0.00
R7476:Map3k9 UTSW 12 81743808 missense probably damaging 1.00
R7638:Map3k9 UTSW 12 81724732 missense probably benign 0.00
X0025:Map3k9 UTSW 12 81724412 missense possibly damaging 0.58
Z1176:Map3k9 UTSW 12 81772782 missense possibly damaging 0.76
Z1177:Map3k9 UTSW 12 81722279 missense probably damaging 0.99
Z1177:Map3k9 UTSW 12 81780846 missense unknown
Predicted Primers PCR Primer
(F):5'- TCGCCACTCAACAATGGTC -3'
(R):5'- AGACCATAGAGAACGTTCGCC -3'

Sequencing Primer
(F):5'- ATTGATGCAAGGCTCCACCG -3'
(R):5'- CAAGAGGCCAAGCTCTTTGC -3'
Posted On2019-06-07