Incidental Mutation 'PIT4366001:Pomt2'
ID554782
Institutional Source Beutler Lab
Gene Symbol Pomt2
Ensembl Gene ENSMUSG00000034126
Gene Nameprotein-O-mannosyltransferase 2
SynonymsA830009D15Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4366001 (G1)
Quality Score103.008
Status Not validated
Chromosome12
Chromosomal Location87106861-87147968 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 87116529 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000035260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037788] [ENSMUST00000222634]
Predicted Effect probably null
Transcript: ENSMUST00000037788
SMART Domains Protein: ENSMUSP00000035260
Gene: ENSMUSG00000034126

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
Pfam:PMT 132 376 5.4e-91 PFAM
MIR 404 460 4.05e-9 SMART
MIR 473 529 5.52e-11 SMART
MIR 534 591 1.21e-7 SMART
Pfam:PMT_4TMC 608 818 5.9e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000222634
Coding Region Coverage
  • 1x: 93.0%
  • 3x: 90.7%
  • 10x: 85.5%
  • 20x: 73.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an integral membrane protein that belongs to the dolichyl-phosphate-mannose-protein mannosyltransferase family. The encoded enzyme is found in the membrane of the endoplasmic reticulum. This protein is a component of the protein O-mannosyltransferase enzyme complex which is involved in modification of the protein alpha-dystroglycan. Mutations in the human gene are a cause of different forms of muscular dystrophy-dystroglycanopathy (MDDG), type A2 (also known as Walker-Warburg syndrome), type B2 and type C2 (also known as limb-girdle muscular dystrophy). [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for one knock-out allele die between E8.5 and E9.5 with abnormal Reichert's membrane and runting. Mice homozygous for another allele die before implantation and arrest at the morula stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C A 11: 120,010,960 S870I possibly damaging Het
Abca13 T C 11: 9,294,962 V2275A probably benign Het
Abcb5 T C 12: 118,936,098 K278R probably damaging Het
Adcy2 TA TAA 13: 68,709,990 probably benign Het
Add3 C T 19: 53,216,867 P16L unknown Het
Akap9 T A 5: 4,046,221 D2365E probably benign Het
Asah1 A G 8: 41,343,746 S300P possibly damaging Het
Astn1 A T 1: 158,597,209 H655L probably benign Het
Astn1 A T 1: 158,597,211 I656F probably benign Het
Bmpr1b T A 3: 141,880,463 T13S probably benign Het
Camsap2 A G 1: 136,280,317 F478L Het
Card10 G A 15: 78,787,431 S611L probably benign Het
Cep68 T C 11: 20,240,007 N335S probably benign Het
Chac1 T C 2: 119,351,505 W35R probably damaging Het
Cntn6 T C 6: 104,832,537 V511A probably benign Het
Cpne9 G T 6: 113,294,746 G356W probably damaging Het
Dnah10 C A 5: 124,775,524 T1939K possibly damaging Het
Dock10 T C 1: 80,595,721 N239D probably benign Het
Dock5 T C 14: 67,824,674 K415R possibly damaging Het
Dtd2 C A 12: 51,999,799 D86Y probably damaging Het
Efcab9 A G 11: 32,523,608 F127S probably damaging Het
Ermp1 T C 19: 29,628,789 H375R probably benign Het
Frem2 A T 3: 53,653,201 M1295K probably damaging Het
Gbp7 T G 3: 142,542,951 I325R probably benign Het
Gpr179 T C 11: 97,336,851 K1493E probably benign Het
Gucy2g T A 19: 55,237,782 E234V probably null Het
Itpr1 T A 6: 108,493,757 C2215* probably null Het
Ltn1 G A 16: 87,380,840 R1634* probably null Het
Lynx1 A T 15: 74,751,409 M58K possibly damaging Het
Macc1 T C 12: 119,446,949 V484A probably benign Het
Map3k9 C T 12: 81,772,761 V240M possibly damaging Het
Marc1 A G 1: 184,807,186 F96S probably benign Het
Mars A G 10: 127,299,398 M608T possibly damaging Het
Mc2r T C 18: 68,407,755 M156V probably benign Het
Mchr1 G T 15: 81,237,216 V56L probably benign Het
Mlxip C T 5: 123,395,110 P61S probably benign Het
Muc4 A G 16: 32,754,796 T1557A unknown Het
Myt1 T C 2: 181,825,938 V1135A probably damaging Het
Ndufaf6 A T 4: 11,073,215 S76T probably benign Het
Ntrk2 A G 13: 59,060,335 Y665C probably damaging Het
Oaz3 T G 3: 94,433,594 R215S unknown Het
Olfr1022 T C 2: 85,868,882 C97R probably damaging Het
Olfr1031 A T 2: 85,992,041 N75Y probably damaging Het
Olfr1133 C T 2: 87,645,190 W311* probably null Het
Olfr417 T C 1: 174,369,090 Y58H probably damaging Het
Perm1 G T 4: 156,218,735 V579L probably benign Het
Phyhipl A G 10: 70,568,958 V140A probably benign Het
Pip5k1c T A 10: 81,309,008 S228T probably damaging Het
Plekhn1 T G 4: 156,224,811 T213P probably damaging Het
Ptcd1 A G 5: 145,151,335 V622A probably benign Het
Ptn T A 6: 36,741,349 H127L probably benign Het
Ptprk A T 10: 28,586,019 M1193L probably benign Het
Ptpru G A 4: 131,799,712 P650S probably benign Het
Pum2 T A 12: 8,733,390 L613Q probably damaging Het
Rapgef6 A G 11: 54,691,620 T1458A probably damaging Het
Sap130 C T 18: 31,677,409 A470V probably benign Het
Sertad2 C A 11: 20,648,116 P104Q probably benign Het
Sfrp4 A T 13: 19,630,244 M324L unknown Het
Sh3bp4 A G 1: 89,145,434 N668S probably benign Het
Snx30 C A 4: 59,894,653 D410E probably benign Het
Spata31 C A 13: 64,921,505 S489* probably null Het
Taok3 T A 5: 117,227,985 M367K probably benign Het
Tfap2a T C 13: 40,721,374 N254D possibly damaging Het
Tgtp1 T G 11: 48,987,040 L279F possibly damaging Het
Tmpo A G 10: 91,163,310 F205S probably damaging Het
Tmprss5 A T 9: 49,112,217 I218L probably benign Het
Tti2 A G 8: 31,151,196 E116G probably benign Het
Vmn2r59 A T 7: 42,045,781 N402K possibly damaging Het
Other mutations in Pomt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Pomt2 APN 12 87124856 missense probably damaging 1.00
IGL00508:Pomt2 APN 12 87119627 missense probably damaging 1.00
IGL01069:Pomt2 APN 12 87110304 missense probably damaging 1.00
IGL01688:Pomt2 APN 12 87147520 missense probably benign
IGL01887:Pomt2 APN 12 87119589 missense probably damaging 1.00
IGL02120:Pomt2 APN 12 87111552 missense probably benign 0.07
IGL02233:Pomt2 APN 12 87111411 missense probably benign 0.00
IGL02305:Pomt2 APN 12 87117929 splice site probably benign
IGL02372:Pomt2 APN 12 87122835 splice site probably benign
IGL02516:Pomt2 APN 12 87119646 missense probably benign 0.00
IGL02616:Pomt2 APN 12 87124862 missense probably damaging 1.00
IGL03039:Pomt2 APN 12 87110366 missense probably benign 0.03
IGL03385:Pomt2 APN 12 87116556 missense probably damaging 1.00
R1055:Pomt2 UTSW 12 87147480 missense possibly damaging 0.49
R1716:Pomt2 UTSW 12 87124836 missense probably benign 0.03
R1880:Pomt2 UTSW 12 87135596 missense probably damaging 1.00
R1881:Pomt2 UTSW 12 87135596 missense probably damaging 1.00
R2011:Pomt2 UTSW 12 87111399 missense possibly damaging 0.95
R2443:Pomt2 UTSW 12 87133380 missense probably damaging 1.00
R2913:Pomt2 UTSW 12 87128969 missense probably damaging 0.98
R4036:Pomt2 UTSW 12 87111522 critical splice donor site probably null
R4482:Pomt2 UTSW 12 87131830 missense probably benign 0.41
R4647:Pomt2 UTSW 12 87118083 missense possibly damaging 0.49
R4758:Pomt2 UTSW 12 87122878 missense probably damaging 1.00
R4872:Pomt2 UTSW 12 87110107 missense possibly damaging 0.89
R5071:Pomt2 UTSW 12 87133460 missense probably damaging 0.96
R5074:Pomt2 UTSW 12 87133460 missense probably damaging 0.96
R5132:Pomt2 UTSW 12 87110347 missense probably damaging 0.98
R5514:Pomt2 UTSW 12 87129023 missense probably damaging 1.00
R5790:Pomt2 UTSW 12 87127378 missense probably damaging 1.00
R6128:Pomt2 UTSW 12 87111335 critical splice donor site probably null
R6370:Pomt2 UTSW 12 87109199 missense probably damaging 1.00
R6631:Pomt2 UTSW 12 87139643 critical splice donor site probably null
R6979:Pomt2 UTSW 12 87130351 missense probably damaging 1.00
R7057:Pomt2 UTSW 12 87127378 missense probably damaging 0.96
R7114:Pomt2 UTSW 12 87110376 missense probably damaging 1.00
R7690:Pomt2 UTSW 12 87130367 missense probably damaging 1.00
R7864:Pomt2 UTSW 12 87122882 missense probably benign 0.00
R8060:Pomt2 UTSW 12 87129006 missense probably damaging 1.00
R8695:Pomt2 UTSW 12 87110016 missense probably benign 0.12
R8851:Pomt2 UTSW 12 87138064 missense probably damaging 0.99
X0026:Pomt2 UTSW 12 87111375 missense possibly damaging 0.93
Z1177:Pomt2 UTSW 12 87111442 missense possibly damaging 0.74
Z1177:Pomt2 UTSW 12 87139681 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCTGTGATCCCGGAAATCC -3'
(R):5'- CTAAGCCTCATGAATGACCCTC -3'

Sequencing Primer
(F):5'- TGTGATCCCGGAAATCCTCATAAAG -3'
(R):5'- CTCTGCTCAGCTTGATAGGGAGAC -3'
Posted On2019-06-07