Incidental Mutation 'PIT4366001:Card10'
ID554792
Institutional Source Beutler Lab
Gene Symbol Card10
Ensembl Gene ENSMUSG00000033170
Gene Namecaspase recruitment domain family, member 10
SynonymsBimp1, CARMA3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #PIT4366001 (G1)
Quality Score129.008
Status Not validated
Chromosome15
Chromosomal Location78775138-78803042 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 78787431 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 611 (S611L)
Ref Sequence ENSEMBL: ENSMUSP00000129513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164826] [ENSMUST00000170584]
Predicted Effect probably benign
Transcript: ENSMUST00000164826
AA Change: S611L

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000129513
Gene: ENSMUSG00000033170
AA Change: S611L

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
low complexity region 54 75 N/A INTRINSIC
Pfam:CARD 77 163 1.1e-22 PFAM
coiled coil region 188 498 N/A INTRINSIC
low complexity region 508 523 N/A INTRINSIC
low complexity region 607 614 N/A INTRINSIC
low complexity region 692 706 N/A INTRINSIC
PDB:3SHW|A 744 1055 1e-7 PDB
Blast:SH3 747 812 8e-8 BLAST
Blast:GuKc 883 1045 1e-19 BLAST
low complexity region 1057 1068 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170584
AA Change: S562L

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000131003
Gene: ENSMUSG00000033170
AA Change: S562L

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
Pfam:CARD 28 114 5.6e-23 PFAM
coiled coil region 139 449 N/A INTRINSIC
low complexity region 459 474 N/A INTRINSIC
low complexity region 558 565 N/A INTRINSIC
low complexity region 643 657 N/A INTRINSIC
PDB:3SHW|A 695 1006 1e-7 PDB
Blast:SH3 698 763 7e-8 BLAST
Blast:GuKc 834 996 1e-19 BLAST
low complexity region 1008 1019 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.0%
  • 3x: 90.7%
  • 10x: 85.5%
  • 20x: 73.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The caspase recruitment domain (CARD) is a protein module that consists of 6 or 7 antiparallel alpha helices. It participates in apoptosis signaling through highly specific protein-protein homophilic interactions. Like several other CARD proteins, CARD10 belongs to the membrane-associated guanylate kinase (MAGUK) family and activates NF-kappa-B (NFKB; see MIM 164011) through BCL10 (MIM 603517) (Wang et al., 2001 [PubMed 11259443]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit partial penetrance of anencephaly and subsequent perinatal lethality of anencephalic embryos. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C A 11: 120,010,960 S870I possibly damaging Het
Abca13 T C 11: 9,294,962 V2275A probably benign Het
Abcb5 T C 12: 118,936,098 K278R probably damaging Het
Adcy2 TA TAA 13: 68,709,990 probably benign Het
Add3 C T 19: 53,216,867 P16L unknown Het
Akap9 T A 5: 4,046,221 D2365E probably benign Het
Asah1 A G 8: 41,343,746 S300P possibly damaging Het
Astn1 A T 1: 158,597,209 H655L probably benign Het
Astn1 A T 1: 158,597,211 I656F probably benign Het
Bmpr1b T A 3: 141,880,463 T13S probably benign Het
Camsap2 A G 1: 136,280,317 F478L Het
Cep68 T C 11: 20,240,007 N335S probably benign Het
Chac1 T C 2: 119,351,505 W35R probably damaging Het
Cntn6 T C 6: 104,832,537 V511A probably benign Het
Cpne9 G T 6: 113,294,746 G356W probably damaging Het
Dnah10 C A 5: 124,775,524 T1939K possibly damaging Het
Dock10 T C 1: 80,595,721 N239D probably benign Het
Dock5 T C 14: 67,824,674 K415R possibly damaging Het
Dtd2 C A 12: 51,999,799 D86Y probably damaging Het
Efcab9 A G 11: 32,523,608 F127S probably damaging Het
Ermp1 T C 19: 29,628,789 H375R probably benign Het
Frem2 A T 3: 53,653,201 M1295K probably damaging Het
Gbp7 T G 3: 142,542,951 I325R probably benign Het
Gpr179 T C 11: 97,336,851 K1493E probably benign Het
Gucy2g T A 19: 55,237,782 E234V probably null Het
Itpr1 T A 6: 108,493,757 C2215* probably null Het
Ltn1 G A 16: 87,380,840 R1634* probably null Het
Lynx1 A T 15: 74,751,409 M58K possibly damaging Het
Macc1 T C 12: 119,446,949 V484A probably benign Het
Map3k9 C T 12: 81,772,761 V240M possibly damaging Het
Marc1 A G 1: 184,807,186 F96S probably benign Het
Mars A G 10: 127,299,398 M608T possibly damaging Het
Mc2r T C 18: 68,407,755 M156V probably benign Het
Mchr1 G T 15: 81,237,216 V56L probably benign Het
Mlxip C T 5: 123,395,110 P61S probably benign Het
Muc4 A G 16: 32,754,796 T1557A unknown Het
Myt1 T C 2: 181,825,938 V1135A probably damaging Het
Ndufaf6 A T 4: 11,073,215 S76T probably benign Het
Ntrk2 A G 13: 59,060,335 Y665C probably damaging Het
Oaz3 T G 3: 94,433,594 R215S unknown Het
Olfr1022 T C 2: 85,868,882 C97R probably damaging Het
Olfr1031 A T 2: 85,992,041 N75Y probably damaging Het
Olfr1133 C T 2: 87,645,190 W311* probably null Het
Olfr417 T C 1: 174,369,090 Y58H probably damaging Het
Perm1 G T 4: 156,218,735 V579L probably benign Het
Phyhipl A G 10: 70,568,958 V140A probably benign Het
Pip5k1c T A 10: 81,309,008 S228T probably damaging Het
Plekhn1 T G 4: 156,224,811 T213P probably damaging Het
Pomt2 A T 12: 87,116,529 probably null Het
Ptcd1 A G 5: 145,151,335 V622A probably benign Het
Ptn T A 6: 36,741,349 H127L probably benign Het
Ptprk A T 10: 28,586,019 M1193L probably benign Het
Ptpru G A 4: 131,799,712 P650S probably benign Het
Pum2 T A 12: 8,733,390 L613Q probably damaging Het
Rapgef6 A G 11: 54,691,620 T1458A probably damaging Het
Sap130 C T 18: 31,677,409 A470V probably benign Het
Sertad2 C A 11: 20,648,116 P104Q probably benign Het
Sfrp4 A T 13: 19,630,244 M324L unknown Het
Sh3bp4 A G 1: 89,145,434 N668S probably benign Het
Snx30 C A 4: 59,894,653 D410E probably benign Het
Spata31 C A 13: 64,921,505 S489* probably null Het
Taok3 T A 5: 117,227,985 M367K probably benign Het
Tfap2a T C 13: 40,721,374 N254D possibly damaging Het
Tgtp1 T G 11: 48,987,040 L279F possibly damaging Het
Tmpo A G 10: 91,163,310 F205S probably damaging Het
Tmprss5 A T 9: 49,112,217 I218L probably benign Het
Tti2 A G 8: 31,151,196 E116G probably benign Het
Vmn2r59 A T 7: 42,045,781 N402K possibly damaging Het
Other mutations in Card10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02061:Card10 APN 15 78778215 missense probably damaging 1.00
IGL02804:Card10 APN 15 78802449 missense probably damaging 1.00
R0529:Card10 UTSW 15 78780475 critical splice donor site probably null
R0571:Card10 UTSW 15 78787401 missense possibly damaging 0.88
R1118:Card10 UTSW 15 78802443 missense possibly damaging 0.90
R1444:Card10 UTSW 15 78787841 splice site probably benign
R1632:Card10 UTSW 15 78791220 nonsense probably null
R1669:Card10 UTSW 15 78793953 missense probably benign 0.20
R1862:Card10 UTSW 15 78780514 missense probably damaging 1.00
R1863:Card10 UTSW 15 78780514 missense probably damaging 1.00
R1997:Card10 UTSW 15 78793975 missense probably damaging 0.99
R2046:Card10 UTSW 15 78787473 missense possibly damaging 0.91
R2084:Card10 UTSW 15 78792971 missense possibly damaging 0.81
R2509:Card10 UTSW 15 78780273 missense probably benign 0.00
R2511:Card10 UTSW 15 78780273 missense probably benign 0.00
R4274:Card10 UTSW 15 78780514 missense probably damaging 1.00
R4887:Card10 UTSW 15 78781524 missense possibly damaging 0.66
R4970:Card10 UTSW 15 78802380 critical splice donor site probably null
R5098:Card10 UTSW 15 78776717 missense probably benign 0.37
R5112:Card10 UTSW 15 78802380 critical splice donor site probably null
R5243:Card10 UTSW 15 78780672 missense possibly damaging 0.70
R5256:Card10 UTSW 15 78778251 missense probably damaging 0.98
R5985:Card10 UTSW 15 78791211 missense probably benign 0.01
R6089:Card10 UTSW 15 78802414 missense probably benign 0.02
R6357:Card10 UTSW 15 78799379 missense probably damaging 1.00
R6545:Card10 UTSW 15 78776810 missense probably damaging 1.00
R6865:Card10 UTSW 15 78802622 missense possibly damaging 0.70
R6907:Card10 UTSW 15 78787471 missense possibly damaging 0.82
R6920:Card10 UTSW 15 78802409 nonsense probably null
R7913:Card10 UTSW 15 78781103 missense possibly damaging 0.63
R7994:Card10 UTSW 15 78781103 missense possibly damaging 0.63
Z1177:Card10 UTSW 15 78795328 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TACTGTTCATGGAAGCCTGG -3'
(R):5'- GGGTCCAGCTTTTACACCTG -3'

Sequencing Primer
(F):5'- TGGAGCAGAGCCATGGC -3'
(R):5'- TCTAGGAAACTGGAGCCTCAC -3'
Posted On2019-06-07