Incidental Mutation 'PIT4366001:Add3'
ID554799
Institutional Source Beutler Lab
Gene Symbol Add3
Ensembl Gene ENSMUSG00000025026
Gene Nameadducin 3 (gamma)
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4366001 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location53140445-53247399 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 53216867 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 16 (P16L)
Ref Sequence ENSEMBL: ENSMUSP00000025999 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025999] [ENSMUST00000050096] [ENSMUST00000111741]
Predicted Effect unknown
Transcript: ENSMUST00000025999
AA Change: P16L
SMART Domains Protein: ENSMUSP00000025999
Gene: ENSMUSG00000025026
AA Change: P16L

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 101 114 N/A INTRINSIC
Aldolase_II 139 321 1.62e-46 SMART
coiled coil region 556 582 N/A INTRINSIC
low complexity region 590 605 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
low complexity region 673 703 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000050096
AA Change: P16L
SMART Domains Protein: ENSMUSP00000052245
Gene: ENSMUSG00000025026
AA Change: P16L

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 101 114 N/A INTRINSIC
Aldolase_II 139 321 1.62e-46 SMART
low complexity region 618 630 N/A INTRINSIC
low complexity region 641 671 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000111741
AA Change: P16L
SMART Domains Protein: ENSMUSP00000107370
Gene: ENSMUSG00000025026
AA Change: P16L

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 101 114 N/A INTRINSIC
Aldolase_II 139 321 1.62e-46 SMART
coiled coil region 556 582 N/A INTRINSIC
low complexity region 590 605 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
low complexity region 673 703 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.0%
  • 3x: 90.7%
  • 10x: 85.5%
  • 20x: 73.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adducins are heteromeric proteins composed of different subunits referred to as adducin alpha, beta and gamma. The three subunits are encoded by distinct genes and belong to a family of membrane skeletal proteins involved in the assembly of spectrin-actin network in erythrocytes and at sites of cell-cell contact in epithelial tissues. While adducins alpha and gamma are ubiquitously expressed, the expression of adducin beta is restricted to brain and hematopoietic tissues. Adducin, originally purified from human erythrocytes, was found to be a heterodimer of adducins alpha and beta. Polymorphisms resulting in amino acid substitutions in these two subunits have been associated with the regulation of blood pressure in an animal model of hypertension. Heterodimers consisting of alpha and gamma subunits have also been described. Structurally, each subunit is comprised of two distinct domains. The amino-terminal region is protease resistant and globular in shape, while the carboxy-terminal region is protease sensitive. The latter contains multiple phosphorylation sites for protein kinase C, the binding site for calmodulin, and is required for association with spectrin and actin. Alternatively spliced adducin gamma transcripts encoding different isoforms have been described. The functions of the different isoforms are not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal blood pressure and show no significant alterations in red blood cell or platelet structure and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C A 11: 120,010,960 S870I possibly damaging Het
Abca13 T C 11: 9,294,962 V2275A probably benign Het
Abcb5 T C 12: 118,936,098 K278R probably damaging Het
Adcy2 TA TAA 13: 68,709,990 probably benign Het
Akap9 T A 5: 4,046,221 D2365E probably benign Het
Asah1 A G 8: 41,343,746 S300P possibly damaging Het
Astn1 A T 1: 158,597,209 H655L probably benign Het
Astn1 A T 1: 158,597,211 I656F probably benign Het
Bmpr1b T A 3: 141,880,463 T13S probably benign Het
Camsap2 A G 1: 136,280,317 F478L Het
Card10 G A 15: 78,787,431 S611L probably benign Het
Cep68 T C 11: 20,240,007 N335S probably benign Het
Chac1 T C 2: 119,351,505 W35R probably damaging Het
Cntn6 T C 6: 104,832,537 V511A probably benign Het
Cpne9 G T 6: 113,294,746 G356W probably damaging Het
Dnah10 C A 5: 124,775,524 T1939K possibly damaging Het
Dock10 T C 1: 80,595,721 N239D probably benign Het
Dock5 T C 14: 67,824,674 K415R possibly damaging Het
Dtd2 C A 12: 51,999,799 D86Y probably damaging Het
Efcab9 A G 11: 32,523,608 F127S probably damaging Het
Ermp1 T C 19: 29,628,789 H375R probably benign Het
Frem2 A T 3: 53,653,201 M1295K probably damaging Het
Gbp7 T G 3: 142,542,951 I325R probably benign Het
Gpr179 T C 11: 97,336,851 K1493E probably benign Het
Gucy2g T A 19: 55,237,782 E234V probably null Het
Itpr1 T A 6: 108,493,757 C2215* probably null Het
Ltn1 G A 16: 87,380,840 R1634* probably null Het
Lynx1 A T 15: 74,751,409 M58K possibly damaging Het
Macc1 T C 12: 119,446,949 V484A probably benign Het
Map3k9 C T 12: 81,772,761 V240M possibly damaging Het
Marc1 A G 1: 184,807,186 F96S probably benign Het
Mars A G 10: 127,299,398 M608T possibly damaging Het
Mc2r T C 18: 68,407,755 M156V probably benign Het
Mchr1 G T 15: 81,237,216 V56L probably benign Het
Mlxip C T 5: 123,395,110 P61S probably benign Het
Muc4 A G 16: 32,754,796 T1557A unknown Het
Myt1 T C 2: 181,825,938 V1135A probably damaging Het
Ndufaf6 A T 4: 11,073,215 S76T probably benign Het
Ntrk2 A G 13: 59,060,335 Y665C probably damaging Het
Oaz3 T G 3: 94,433,594 R215S unknown Het
Olfr1022 T C 2: 85,868,882 C97R probably damaging Het
Olfr1031 A T 2: 85,992,041 N75Y probably damaging Het
Olfr1133 C T 2: 87,645,190 W311* probably null Het
Olfr417 T C 1: 174,369,090 Y58H probably damaging Het
Perm1 G T 4: 156,218,735 V579L probably benign Het
Phyhipl A G 10: 70,568,958 V140A probably benign Het
Pip5k1c T A 10: 81,309,008 S228T probably damaging Het
Plekhn1 T G 4: 156,224,811 T213P probably damaging Het
Pomt2 A T 12: 87,116,529 probably null Het
Ptcd1 A G 5: 145,151,335 V622A probably benign Het
Ptn T A 6: 36,741,349 H127L probably benign Het
Ptprk A T 10: 28,586,019 M1193L probably benign Het
Ptpru G A 4: 131,799,712 P650S probably benign Het
Pum2 T A 12: 8,733,390 L613Q probably damaging Het
Rapgef6 A G 11: 54,691,620 T1458A probably damaging Het
Sap130 C T 18: 31,677,409 A470V probably benign Het
Sertad2 C A 11: 20,648,116 P104Q probably benign Het
Sfrp4 A T 13: 19,630,244 M324L unknown Het
Sh3bp4 A G 1: 89,145,434 N668S probably benign Het
Snx30 C A 4: 59,894,653 D410E probably benign Het
Spata31 C A 13: 64,921,505 S489* probably null Het
Taok3 T A 5: 117,227,985 M367K probably benign Het
Tfap2a T C 13: 40,721,374 N254D possibly damaging Het
Tgtp1 T G 11: 48,987,040 L279F possibly damaging Het
Tmpo A G 10: 91,163,310 F205S probably damaging Het
Tmprss5 A T 9: 49,112,217 I218L probably benign Het
Tti2 A G 8: 31,151,196 E116G probably benign Het
Vmn2r59 A T 7: 42,045,781 N402K possibly damaging Het
Other mutations in Add3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01744:Add3 APN 19 53239430 missense probably damaging 1.00
IGL02177:Add3 APN 19 53216892 nonsense probably null
IGL03093:Add3 APN 19 53231207 missense probably damaging 1.00
IGL03047:Add3 UTSW 19 53242591 missense probably benign 0.00
PIT4243001:Add3 UTSW 19 53236690 missense probably benign 0.00
R0087:Add3 UTSW 19 53226607 missense probably damaging 1.00
R0335:Add3 UTSW 19 53236828 missense probably benign 0.00
R0346:Add3 UTSW 19 53216956 nonsense probably null
R0514:Add3 UTSW 19 53236843 nonsense probably null
R0692:Add3 UTSW 19 53216952 missense probably damaging 1.00
R1437:Add3 UTSW 19 53233678 missense probably damaging 0.98
R1747:Add3 UTSW 19 53242550 missense probably benign 0.41
R2926:Add3 UTSW 19 53226822 intron probably null
R4192:Add3 UTSW 19 53242524 missense probably benign 0.00
R4780:Add3 UTSW 19 53234792 missense possibly damaging 0.64
R5019:Add3 UTSW 19 53242571 missense probably damaging 0.99
R5486:Add3 UTSW 19 53244387 missense probably benign 0.00
R5526:Add3 UTSW 19 53226607 missense probably damaging 1.00
R5580:Add3 UTSW 19 53245211 missense probably damaging 1.00
R5851:Add3 UTSW 19 53236774 missense probably damaging 1.00
R5863:Add3 UTSW 19 53233870 missense probably benign 0.00
R5951:Add3 UTSW 19 53244289 intron probably null
R6229:Add3 UTSW 19 53234846 missense probably benign 0.35
R7017:Add3 UTSW 19 53233853 missense possibly damaging 0.94
R7190:Add3 UTSW 19 53216899 nonsense probably null
R7222:Add3 UTSW 19 53216846 missense unknown
R7231:Add3 UTSW 19 53233146 missense probably benign 0.00
R7532:Add3 UTSW 19 53232158 missense probably damaging 1.00
R7557:Add3 UTSW 19 53239437 missense probably damaging 0.98
R7726:Add3 UTSW 19 53239461 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGACCTTTCTCCATGATGC -3'
(R):5'- AGAGCTCTGCAACTCACAG -3'

Sequencing Primer
(F):5'- CAGTCCCGAAGCTGCTTTTAAAAG -3'
(R):5'- TCTGCAACTCACAGGGCTCTG -3'
Posted On2019-06-07