Incidental Mutation 'PIT4366001:Gucy2g'
ID554800
Institutional Source Beutler Lab
Gene Symbol Gucy2g
Ensembl Gene ENSMUSG00000055523
Gene Nameguanylate cyclase 2g
SynonymsGC-G, 2410077I05Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4366001 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location55198297-55241236 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55237782 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 234 (E234V)
Ref Sequence ENSEMBL: ENSMUSP00000068253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069183]
Predicted Effect probably null
Transcript: ENSMUST00000069183
AA Change: E234V

PolyPhen 2 Score 0.508 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000068253
Gene: ENSMUSG00000055523
AA Change: E234V

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
Pfam:ANF_receptor 65 416 5.2e-36 PFAM
low complexity region 471 487 N/A INTRINSIC
Pfam:Pkinase 574 826 2e-26 PFAM
Pfam:Pkinase_Tyr 577 826 6e-35 PFAM
CYCc 865 1059 6.42e-96 SMART
Coding Region Coverage
  • 1x: 93.0%
  • 3x: 90.7%
  • 10x: 85.5%
  • 20x: 73.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are viable and fertile with no gross abnormalities and are protected against acute ischemia induced renal injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C A 11: 120,010,960 S870I possibly damaging Het
Abca13 T C 11: 9,294,962 V2275A probably benign Het
Abcb5 T C 12: 118,936,098 K278R probably damaging Het
Adcy2 TA TAA 13: 68,709,990 probably benign Het
Add3 C T 19: 53,216,867 P16L unknown Het
Akap9 T A 5: 4,046,221 D2365E probably benign Het
Asah1 A G 8: 41,343,746 S300P possibly damaging Het
Astn1 A T 1: 158,597,209 H655L probably benign Het
Astn1 A T 1: 158,597,211 I656F probably benign Het
Bmpr1b T A 3: 141,880,463 T13S probably benign Het
Camsap2 A G 1: 136,280,317 F478L Het
Card10 G A 15: 78,787,431 S611L probably benign Het
Cep68 T C 11: 20,240,007 N335S probably benign Het
Chac1 T C 2: 119,351,505 W35R probably damaging Het
Cntn6 T C 6: 104,832,537 V511A probably benign Het
Cpne9 G T 6: 113,294,746 G356W probably damaging Het
Dnah10 C A 5: 124,775,524 T1939K possibly damaging Het
Dock10 T C 1: 80,595,721 N239D probably benign Het
Dock5 T C 14: 67,824,674 K415R possibly damaging Het
Dtd2 C A 12: 51,999,799 D86Y probably damaging Het
Efcab9 A G 11: 32,523,608 F127S probably damaging Het
Ermp1 T C 19: 29,628,789 H375R probably benign Het
Frem2 A T 3: 53,653,201 M1295K probably damaging Het
Gbp7 T G 3: 142,542,951 I325R probably benign Het
Gpr179 T C 11: 97,336,851 K1493E probably benign Het
Itpr1 T A 6: 108,493,757 C2215* probably null Het
Ltn1 G A 16: 87,380,840 R1634* probably null Het
Lynx1 A T 15: 74,751,409 M58K possibly damaging Het
Macc1 T C 12: 119,446,949 V484A probably benign Het
Map3k9 C T 12: 81,772,761 V240M possibly damaging Het
Marc1 A G 1: 184,807,186 F96S probably benign Het
Mars A G 10: 127,299,398 M608T possibly damaging Het
Mc2r T C 18: 68,407,755 M156V probably benign Het
Mchr1 G T 15: 81,237,216 V56L probably benign Het
Mlxip C T 5: 123,395,110 P61S probably benign Het
Muc4 A G 16: 32,754,796 T1557A unknown Het
Myt1 T C 2: 181,825,938 V1135A probably damaging Het
Ndufaf6 A T 4: 11,073,215 S76T probably benign Het
Ntrk2 A G 13: 59,060,335 Y665C probably damaging Het
Oaz3 T G 3: 94,433,594 R215S unknown Het
Olfr1022 T C 2: 85,868,882 C97R probably damaging Het
Olfr1031 A T 2: 85,992,041 N75Y probably damaging Het
Olfr1133 C T 2: 87,645,190 W311* probably null Het
Olfr417 T C 1: 174,369,090 Y58H probably damaging Het
Perm1 G T 4: 156,218,735 V579L probably benign Het
Phyhipl A G 10: 70,568,958 V140A probably benign Het
Pip5k1c T A 10: 81,309,008 S228T probably damaging Het
Plekhn1 T G 4: 156,224,811 T213P probably damaging Het
Pomt2 A T 12: 87,116,529 probably null Het
Ptcd1 A G 5: 145,151,335 V622A probably benign Het
Ptn T A 6: 36,741,349 H127L probably benign Het
Ptprk A T 10: 28,586,019 M1193L probably benign Het
Ptpru G A 4: 131,799,712 P650S probably benign Het
Pum2 T A 12: 8,733,390 L613Q probably damaging Het
Rapgef6 A G 11: 54,691,620 T1458A probably damaging Het
Sap130 C T 18: 31,677,409 A470V probably benign Het
Sertad2 C A 11: 20,648,116 P104Q probably benign Het
Sfrp4 A T 13: 19,630,244 M324L unknown Het
Sh3bp4 A G 1: 89,145,434 N668S probably benign Het
Snx30 C A 4: 59,894,653 D410E probably benign Het
Spata31 C A 13: 64,921,505 S489* probably null Het
Taok3 T A 5: 117,227,985 M367K probably benign Het
Tfap2a T C 13: 40,721,374 N254D possibly damaging Het
Tgtp1 T G 11: 48,987,040 L279F possibly damaging Het
Tmpo A G 10: 91,163,310 F205S probably damaging Het
Tmprss5 A T 9: 49,112,217 I218L probably benign Het
Tti2 A G 8: 31,151,196 E116G probably benign Het
Vmn2r59 A T 7: 42,045,781 N402K possibly damaging Het
Other mutations in Gucy2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Gucy2g APN 19 55233103 missense probably benign 0.01
IGL01954:Gucy2g APN 19 55198691 missense probably benign 0.01
IGL01969:Gucy2g APN 19 55227438 missense probably benign 0.00
IGL02164:Gucy2g APN 19 55238023 missense probably benign
IGL02534:Gucy2g APN 19 55241068 missense probably damaging 1.00
IGL02667:Gucy2g APN 19 55206177 missense possibly damaging 0.64
IGL02755:Gucy2g APN 19 55210354 missense probably benign 0.10
IGL03187:Gucy2g APN 19 55231052 missense possibly damaging 0.91
IGL03354:Gucy2g APN 19 55233080 missense possibly damaging 0.95
R0040:Gucy2g UTSW 19 55217302 missense possibly damaging 0.73
R0126:Gucy2g UTSW 19 55241166 missense probably benign
R0318:Gucy2g UTSW 19 55237798 missense probably benign 0.00
R0576:Gucy2g UTSW 19 55198770 missense probably damaging 1.00
R0604:Gucy2g UTSW 19 55203087 missense probably benign 0.00
R0962:Gucy2g UTSW 19 55210284 nonsense probably null
R1348:Gucy2g UTSW 19 55222906 missense possibly damaging 0.68
R1458:Gucy2g UTSW 19 55215036 splice site probably benign
R1693:Gucy2g UTSW 19 55222926 missense probably damaging 1.00
R1795:Gucy2g UTSW 19 55199541 missense probably damaging 1.00
R1804:Gucy2g UTSW 19 55210309 missense probably benign 0.34
R1830:Gucy2g UTSW 19 55222930 missense possibly damaging 0.94
R1902:Gucy2g UTSW 19 55210237 missense probably benign 0.20
R1927:Gucy2g UTSW 19 55237759 missense probably benign 0.02
R1969:Gucy2g UTSW 19 55222896 missense possibly damaging 0.90
R1969:Gucy2g UTSW 19 55233053 missense probably benign 0.42
R2071:Gucy2g UTSW 19 55222340 missense possibly damaging 0.72
R2842:Gucy2g UTSW 19 55240947 missense probably damaging 1.00
R2971:Gucy2g UTSW 19 55210276 missense probably damaging 1.00
R4202:Gucy2g UTSW 19 55229769 missense possibly damaging 0.96
R4405:Gucy2g UTSW 19 55237837 missense probably benign 0.08
R4407:Gucy2g UTSW 19 55237837 missense probably benign 0.08
R4614:Gucy2g UTSW 19 55202147 nonsense probably null
R4671:Gucy2g UTSW 19 55238068 missense probably damaging 1.00
R4684:Gucy2g UTSW 19 55206256 missense probably damaging 1.00
R4837:Gucy2g UTSW 19 55226053 missense probably benign
R4969:Gucy2g UTSW 19 55226013 missense probably benign
R5050:Gucy2g UTSW 19 55240935 missense probably benign 0.05
R5059:Gucy2g UTSW 19 55226071 missense probably benign 0.00
R5070:Gucy2g UTSW 19 55229787 missense probably damaging 0.98
R5288:Gucy2g UTSW 19 55215116 missense probably damaging 1.00
R5384:Gucy2g UTSW 19 55215116 missense probably damaging 1.00
R5386:Gucy2g UTSW 19 55215116 missense probably damaging 1.00
R5497:Gucy2g UTSW 19 55198701 missense probably benign 0.00
R5531:Gucy2g UTSW 19 55241140 missense probably benign 0.24
R5536:Gucy2g UTSW 19 55237927 missense probably benign 0.05
R5679:Gucy2g UTSW 19 55231079 missense possibly damaging 0.87
R5715:Gucy2g UTSW 19 55233155 missense possibly damaging 0.93
R5941:Gucy2g UTSW 19 55215131 missense probably damaging 1.00
R6250:Gucy2g UTSW 19 55217424 missense probably damaging 0.99
R6288:Gucy2g UTSW 19 55227513 missense probably benign 0.01
R6378:Gucy2g UTSW 19 55240945 missense probably benign 0.00
R6605:Gucy2g UTSW 19 55241028 missense probably damaging 1.00
R7020:Gucy2g UTSW 19 55233050 missense probably damaging 0.98
R7064:Gucy2g UTSW 19 55210332 missense probably benign 0.01
R7078:Gucy2g UTSW 19 55241151 missense probably damaging 1.00
R7402:Gucy2g UTSW 19 55206293 missense probably damaging 1.00
R7539:Gucy2g UTSW 19 55203154 missense probably damaging 0.99
R7561:Gucy2g UTSW 19 55206340 missense probably benign 0.38
R7583:Gucy2g UTSW 19 55235615 missense probably damaging 1.00
R7804:Gucy2g UTSW 19 55228152 missense probably benign 0.02
R7880:Gucy2g UTSW 19 55206280 missense probably damaging 1.00
R7963:Gucy2g UTSW 19 55206280 missense probably damaging 1.00
Z1177:Gucy2g UTSW 19 55210377 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGCACAACTCTATAAGATCTGTG -3'
(R):5'- CCAAGCAGGAAATCAGTGCG -3'

Sequencing Primer
(F):5'- GTGATTTCACATCACATGCata -3'
(R):5'- CAGGAAATCAGTGCGGTGCTTC -3'
Posted On2019-06-07