Mutagenetix > Incidental Mutations

Incidental Mutation 'PIT4354001:Cubn'

List |< first << previous [record 6 of 39] next >> last >|

554803

Institutional Source

Beutler Lab

Gene Symbol

Cubn

Ensembl Gene

ENSMUSG00000026726

Gene Name

cubilin (intrinsic factor-cobalamin receptor)

Synonyms

D2Wsu88e

Accession Numbers

Genbank: NM_001081084; MGI: 1931256

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

PIT4354001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

13276338-13491813 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 13468852 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 427 (Q427*)

Ref Sequence

ENSEMBL: ENSMUSP00000089009 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091436]

Predicted Effect

probably null
Transcript: ENSMUST00000091436
AA Change: Q427*

SMART Domains

Protein: ENSMUSP00000089009
Gene: ENSMUSG00000026726
AA Change: Q427*

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
EGF	132	165	2.14e-5	SMART
EGF_CA	167	208	1.95e-8	SMART
EGF	213	258	2.85e-1	SMART
EGF_CA	260	301	2.66e-10	SMART
EGF_CA	302	345	7.07e-6	SMART
EGF	349	393	1.01e-1	SMART
EGF	398	430	3.73e-5	SMART
EGF_CA	432	468	8.63e-10	SMART
CUB	474	586	4.4e-21	SMART
CUB	590	702	3.82e-39	SMART
CUB	708	816	3.66e-18	SMART
CUB	817	928	3.09e-25	SMART
CUB	932	1042	1.29e-36	SMART
CUB	1048	1161	3.46e-37	SMART
CUB	1165	1277	7.24e-40	SMART
CUB	1278	1389	8.33e-31	SMART
CUB	1391	1506	3.08e-43	SMART
CUB	1510	1619	1.9e-34	SMART
CUB	1620	1734	7.24e-40	SMART
CUB	1738	1850	6.02e-37	SMART
CUB	1852	1963	1.57e-26	SMART
CUB	1978	2091	3.46e-28	SMART
CUB	2092	2213	2.88e-34	SMART
CUB	2217	2334	4.13e-35	SMART
CUB	2336	2448	3.1e-39	SMART
CUB	2452	2565	5.37e-34	SMART
CUB	2570	2687	3e-23	SMART
CUB	2689	2801	3.1e-39	SMART
CUB	2805	2919	2.36e-21	SMART
CUB	2920	3035	6.18e-25	SMART
CUB	3037	3150	5.16e-36	SMART
CUB	3157	3274	1.68e-35	SMART
CUB	3278	3393	7.17e-12	SMART
CUB	3395	3507	2.49e-29	SMART
CUB	3511	3623	2.4e-22	SMART

Coding Region Coverage

1x: 92.5%
3x: 90.1%
10x: 83.2%
20x: 69.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cubilin (CUBN) acts as a receptor for intrinsic factor-vitamin B12 complexes. The role of receptor is supported by the presence of 27 CUB domains. Cubulin is located within the epithelium of intestine and kidney. Mutations in CUBN may play a role in autosomal recessive megaloblastic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis, yolk sac and allantoic vasculature defects, embryonic and visceral endoderm defects, and lack somites. Heterozygotes display incomplete penetrance of premature death. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted, other(1) Gene trapped(3)

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arap2	A	T	5: 62,654,049	Y1140N	probably damaging	Het
Ccdc83	A	T	7: 90,223,974	M391K	probably benign	Het
Cntnap1	A	T	11: 101,181,297	I459F	probably damaging	Het
Cr2	T	A	1: 195,166,309	Y302F	probably damaging	Het
Ctu2	A	T	8: 122,478,975	D179V	probably damaging	Het
Depdc7	A	G	2: 104,728,188	S163P	probably benign	Het
Eif2s3y	C	T	Y: 1,020,126	R385C	probably benign	Het
Gigyf1	A	G	5: 137,524,104	K728R	unknown	Het
Gm1587	G	A	14: 77,797,033	R32*	probably null	Het
Gm17689	T	A	9: 36,581,301	S103C	possibly damaging	Het
Hfe2	T	C	3: 96,528,445	C340R	probably damaging	Het
Isy1	A	G	6: 87,833,671	I53T	possibly damaging	Het
Myh8	A	T	11: 67,289,630	N564I	probably benign	Het
Neb	A	T	2: 52,245,318	I3260N	probably damaging	Het
Npc1	C	T	18: 12,211,535	G426E	probably benign	Het
Nrd1	G	A	4: 109,054,025		probably null	Het
Olfr1221	C	A	2: 89,112,486	E9*	probably null	Het
Olfr1257	T	A	2: 89,881,508	S227R	probably benign	Het
Olfr56	G	A	11: 49,134,305	V38M	probably damaging	Het
Prss51	T	A	14: 64,097,097	V91D	probably damaging	Het
Qpct	A	C	17: 79,081,759	Y280S	probably benign	Het
Rbpms	A	G	8: 33,806,838	V137A	possibly damaging	Het
Rgl2	T	A	17: 33,933,940	M441K	possibly damaging	Het
Sdhaf3	A	T	6: 6,956,072	I16F	possibly damaging	Het
Slc38a3	T	G	9: 107,657,649	N176H	probably benign	Het
Sos1	T	C	17: 80,449,356	S256G	possibly damaging	Het
Spg11	A	T	2: 122,088,185	C988S	probably damaging	Het
Sync	A	T	4: 129,306,654	Q451L	possibly damaging	Het
Tbc1d31	A	G	15: 57,967,933	Y929C	probably benign	Het
Thbs2	G	A	17: 14,689,968	T123I	probably damaging	Het
Thsd7a	A	C	6: 12,331,927		probably null	Het
Tnfrsf11a	T	C	1: 105,821,517	L220P	probably damaging	Het
Trbv13-2	G	A	6: 41,121,818	C109Y	probably damaging	Het
Ugt3a1	G	A	15: 9,306,360	W198*	probably null	Het
Usp14	G	A	18: 9,996,189	R464W	probably damaging	Het
Vmn1r2	C	T	4: 3,172,162	S27L	probably benign	Het
Vmn1r68	T	A	7: 10,528,031	N47Y	probably benign	Het
Zfc3h1	T	A	10: 115,427,039	Y1719*	probably null	Het

Other mutations in Cubn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Cubn	APN	2	13491820	unclassified	probably benign
IGL00228:Cubn	APN	2	13456697	missense	probably damaging	1.00
IGL00231:Cubn	APN	2	13381849	missense	possibly damaging	0.89
IGL00327:Cubn	APN	2	13427056	missense	possibly damaging	0.73
IGL00470:Cubn	APN	2	13278418	missense	probably benign	0.00
IGL00519:Cubn	APN	2	13282919	missense	probably benign	0.00
IGL00562:Cubn	APN	2	13294230	missense	probably benign	0.01
IGL00678:Cubn	APN	2	13467710	missense	possibly damaging	0.47
IGL00834:Cubn	APN	2	13381927	missense	probably damaging	1.00
IGL00946:Cubn	APN	2	13456623	missense	probably damaging	0.98
IGL00971:Cubn	APN	2	13278408	missense	possibly damaging	0.77
IGL01124:Cubn	APN	2	13478093	missense	possibly damaging	0.62
IGL01287:Cubn	APN	2	13310566	missense	probably damaging	1.00
IGL01410:Cubn	APN	2	13465908	missense	probably benign	0.31
IGL01418:Cubn	APN	2	13284041	missense	probably benign	0.01
IGL01450:Cubn	APN	2	13350862	splice site	probably benign
IGL01534:Cubn	APN	2	13465933	nonsense	probably null
IGL01584:Cubn	APN	2	13308661	splice site	probably benign
IGL01595:Cubn	APN	2	13325216	missense	probably benign	0.05
IGL01625:Cubn	APN	2	13306274	missense	possibly damaging	0.76
IGL01732:Cubn	APN	2	13489936	nonsense	probably null
IGL01972:Cubn	APN	2	13446072	missense	possibly damaging	0.90
IGL02027:Cubn	APN	2	13287594	missense	probably damaging	1.00
IGL02033:Cubn	APN	2	13339846	missense	probably damaging	0.98
IGL02124:Cubn	APN	2	13381837	missense	probably damaging	0.99
IGL02335:Cubn	APN	2	13427834	splice site	probably null
IGL02491:Cubn	APN	2	13321228	missense	probably damaging	1.00
IGL02686:Cubn	APN	2	13325226	missense	possibly damaging	0.92
IGL02707:Cubn	APN	2	13446032	missense	probably damaging	0.99
IGL02746:Cubn	APN	2	13445040	missense	probably damaging	1.00
IGL02873:Cubn	APN	2	13294370	missense	probably benign	0.07
IGL02897:Cubn	APN	2	13318312	missense	possibly damaging	0.55
IGL03078:Cubn	APN	2	13287094	missense	possibly damaging	0.87
IGL03245:Cubn	APN	2	13355689	missense	probably benign	0.09
IGL03289:Cubn	APN	2	13426967	missense	probably benign	0.00
IGL03335:Cubn	APN	2	13360329	missense	probably damaging	1.00
IGL03355:Cubn	APN	2	13478057	splice site	probably null
mellow	UTSW	2	13478078	missense	probably damaging	1.00
PIT4495001:Cubn	UTSW	2	13491750	missense	probably benign	0.00
R0145:Cubn	UTSW	2	13306432	missense	probably damaging	1.00
R0220:Cubn	UTSW	2	13356709	missense	probably damaging	1.00
R0254:Cubn	UTSW	2	13424694	missense	probably benign	0.01
R0254:Cubn	UTSW	2	13440514	missense	possibly damaging	0.84
R0254:Cubn	UTSW	2	13476035	critical splice donor site	probably null
R0360:Cubn	UTSW	2	13310507	splice site	probably benign
R0364:Cubn	UTSW	2	13310507	splice site	probably benign
R0383:Cubn	UTSW	2	13430959	missense	probably damaging	1.00
R0419:Cubn	UTSW	2	13469763	missense	possibly damaging	0.77
R0419:Cubn	UTSW	2	13469764	missense	possibly damaging	0.87
R0498:Cubn	UTSW	2	13444267	missense	probably damaging	0.99
R0560:Cubn	UTSW	2	13428680	missense	probably damaging	1.00
R0615:Cubn	UTSW	2	13360252	splice site	probably null
R0735:Cubn	UTSW	2	13491689	splice site	probably benign
R0780:Cubn	UTSW	2	13456613	missense	probably damaging	1.00
R0899:Cubn	UTSW	2	13362328	missense	possibly damaging	0.54
R1118:Cubn	UTSW	2	13336242	missense	possibly damaging	0.78
R1182:Cubn	UTSW	2	13445000	missense	probably damaging	0.98
R1439:Cubn	UTSW	2	13287568	missense	probably damaging	0.96
R1450:Cubn	UTSW	2	13360319	missense	probably damaging	1.00
R1464:Cubn	UTSW	2	13325288	missense	possibly damaging	0.87
R1464:Cubn	UTSW	2	13325288	missense	possibly damaging	0.87
R1476:Cubn	UTSW	2	13476120	missense	probably benign	0.04
R1508:Cubn	UTSW	2	13427105	missense	probably benign	0.25
R1532:Cubn	UTSW	2	13287661	missense	probably damaging	1.00
R1562:Cubn	UTSW	2	13427967	missense	probably damaging	1.00
R1598:Cubn	UTSW	2	13469789	missense	probably benign	0.00
R1761:Cubn	UTSW	2	13489317	critical splice donor site	probably null
R1862:Cubn	UTSW	2	13308561	missense	probably damaging	1.00
R1874:Cubn	UTSW	2	13323002	missense	probably damaging	1.00
R1923:Cubn	UTSW	2	13310526	missense	probably damaging	1.00
R1944:Cubn	UTSW	2	13278538	missense	probably benign	0.01
R1960:Cubn	UTSW	2	13340017	splice site	probably null
R2021:Cubn	UTSW	2	13308549	missense	probably benign	0.09
R2137:Cubn	UTSW	2	13336167	missense	probably benign	0.01
R2138:Cubn	UTSW	2	13444378	missense	probably damaging	0.99
R2139:Cubn	UTSW	2	13336167	missense	probably benign	0.01
R2179:Cubn	UTSW	2	13318242	missense	possibly damaging	0.85
R2328:Cubn	UTSW	2	13404080	nonsense	probably null
R2369:Cubn	UTSW	2	13491217	missense	probably damaging	1.00
R2428:Cubn	UTSW	2	13476150	missense	probably damaging	1.00
R2435:Cubn	UTSW	2	13318272	missense	probably damaging	1.00
R2567:Cubn	UTSW	2	13278356	splice site	probably null
R2850:Cubn	UTSW	2	13322953	missense	probably damaging	1.00
R2853:Cubn	UTSW	2	13430834	missense	probably benign	0.00
R2893:Cubn	UTSW	2	13358139	missense	possibly damaging	0.61
R3107:Cubn	UTSW	2	13362347	missense	possibly damaging	0.73
R3109:Cubn	UTSW	2	13362347	missense	possibly damaging	0.73
R3119:Cubn	UTSW	2	13358162	missense	possibly damaging	0.90
R3405:Cubn	UTSW	2	13333508	missense	probably benign	0.00
R3703:Cubn	UTSW	2	13350943	missense	probably damaging	1.00
R3704:Cubn	UTSW	2	13350943	missense	probably damaging	1.00
R3705:Cubn	UTSW	2	13350943	missense	probably damaging	1.00
R3764:Cubn	UTSW	2	13331585	missense	possibly damaging	0.79
R3792:Cubn	UTSW	2	13427914	missense	probably damaging	1.00
R3802:Cubn	UTSW	2	13360353	missense	probably benign	0.01
R3813:Cubn	UTSW	2	13294325	missense	probably damaging	1.00
R3845:Cubn	UTSW	2	13283008	missense	probably damaging	1.00
R3846:Cubn	UTSW	2	13283008	missense	probably damaging	1.00
R3900:Cubn	UTSW	2	13286980	critical splice donor site	probably null
R3921:Cubn	UTSW	2	13326677	missense	probably damaging	1.00
R4075:Cubn	UTSW	2	13313999	missense	possibly damaging	0.58
R4082:Cubn	UTSW	2	13428563	intron	probably benign
R4405:Cubn	UTSW	2	13466030	missense	probably damaging	1.00
R4615:Cubn	UTSW	2	13428749	missense	probably damaging	1.00
R4629:Cubn	UTSW	2	13313979	splice site	probably null
R4770:Cubn	UTSW	2	13314767	missense	possibly damaging	0.92
R4799:Cubn	UTSW	2	13287024	missense	possibly damaging	0.94
R4799:Cubn	UTSW	2	13351058	missense	probably damaging	1.00
R4812:Cubn	UTSW	2	13459076	missense	probably damaging	1.00
R4825:Cubn	UTSW	2	13325225	missense	probably damaging	1.00
R4934:Cubn	UTSW	2	13489910	missense	probably benign	0.06
R4967:Cubn	UTSW	2	13348045	missense	probably benign	0.01
R5187:Cubn	UTSW	2	13287568	missense	probably damaging	0.96
R5232:Cubn	UTSW	2	13478202	nonsense	probably null
R5305:Cubn	UTSW	2	13388939	missense	probably damaging	1.00
R5506:Cubn	UTSW	2	13491695	splice site	probably null
R5530:Cubn	UTSW	2	13308523	missense	probably damaging	1.00
R5531:Cubn	UTSW	2	13350932	missense	probably benign	0.00
R5737:Cubn	UTSW	2	13388891	missense	probably damaging	1.00
R5886:Cubn	UTSW	2	13320023	splice site	probably benign
R5923:Cubn	UTSW	2	13486078	missense	possibly damaging	0.73
R6032:Cubn	UTSW	2	13325184	missense	probably benign	0.12
R6032:Cubn	UTSW	2	13325184	missense	probably benign	0.12
R6084:Cubn	UTSW	2	13430897	missense	probably damaging	1.00
R6087:Cubn	UTSW	2	13427847	missense	probably damaging	1.00
R6133:Cubn	UTSW	2	13308618	missense	probably benign	0.29
R6181:Cubn	UTSW	2	13349876	missense	probably benign	0.31
R6301:Cubn	UTSW	2	13478078	missense	probably damaging	1.00
R6320:Cubn	UTSW	2	13280195	missense	probably damaging	1.00
R6368:Cubn	UTSW	2	13430995	missense	probably damaging	0.96
R6368:Cubn	UTSW	2	13476123	missense	probably damaging	0.98
R6383:Cubn	UTSW	2	13427835	critical splice donor site	probably null
R6393:Cubn	UTSW	2	13355680	missense	probably benign	0.08
R6408:Cubn	UTSW	2	13294203	missense	probably damaging	1.00
R6470:Cubn	UTSW	2	13322993	missense	possibly damaging	0.87
R6532:Cubn	UTSW	2	13459002	missense	probably benign	0.01
R6599:Cubn	UTSW	2	13310673	missense	possibly damaging	0.95
R6629:Cubn	UTSW	2	13430872	missense	probably damaging	1.00
R6641:Cubn	UTSW	2	13476064	missense	probably damaging	1.00
R6800:Cubn	UTSW	2	13321255	missense	probably damaging	1.00
R6823:Cubn	UTSW	2	13445029	missense	probably benign	0.21
R6847:Cubn	UTSW	2	13444253	critical splice donor site	probably null
R6885:Cubn	UTSW	2	13318278	missense	probably damaging	1.00
R6962:Cubn	UTSW	2	13348029	missense	probably benign	0.03
R6973:Cubn	UTSW	2	13381837	missense	possibly damaging	0.61
R6975:Cubn	UTSW	2	13486789	missense	probably damaging	0.99
R7076:Cubn	UTSW	2	13306280	missense	probably benign	0.00
R7076:Cubn	UTSW	2	13306281	missense	probably benign	0.10
R7086:Cubn	UTSW	2	13319858	missense	probably damaging	0.98
R7162:Cubn	UTSW	2	13342498	missense	probably damaging	0.96
R7203:Cubn	UTSW	2	13351003	missense	probably benign	0.01
R7292:Cubn	UTSW	2	13424739	missense	probably damaging	0.99
R7307:Cubn	UTSW	2	13340332	missense	probably damaging	0.99
R7329:Cubn	UTSW	2	13468771	missense	probably damaging	0.99
R7395:Cubn	UTSW	2	13287064	missense	probably damaging	1.00
R7417:Cubn	UTSW	2	13426967	missense	probably benign	0.00
R7429:Cubn	UTSW	2	13322993	missense	possibly damaging	0.87
R7430:Cubn	UTSW	2	13322993	missense	possibly damaging	0.87
R7443:Cubn	UTSW	2	13455509	missense	probably damaging	1.00
R7699:Cubn	UTSW	2	13348178	missense	probably benign
R7699:Cubn	UTSW	2	13489917	missense	possibly damaging	0.74
R7700:Cubn	UTSW	2	13348178	missense	probably benign
R7700:Cubn	UTSW	2	13489917	missense	possibly damaging	0.74
R7751:Cubn	UTSW	2	13360365	missense	probably damaging	1.00
R7755:Cubn	UTSW	2	13280078	missense	probably benign	0.11
R7759:Cubn	UTSW	2	13348150	missense	probably damaging	1.00
R7903:Cubn	UTSW	2	13468869	missense	probably damaging	0.97
R7921:Cubn	UTSW	2	13424727	missense	probably benign	0.22
R7988:Cubn	UTSW	2	13332355	missense	probably benign	0.43
R8010:Cubn	UTSW	2	13336086	critical splice donor site	probably null
R8020:Cubn	UTSW	2	13479178	missense	probably benign	0.01
R8120:Cubn	UTSW	2	13331660	missense	probably damaging	1.00
R8133:Cubn	UTSW	2	13388848	missense	probably damaging	1.00
R8185:Cubn	UTSW	2	13294318	missense	probably benign	0.11
R8224:Cubn	UTSW	2	13349877	missense	probably benign	0.16
R8289:Cubn	UTSW	2	13486802	missense	probably benign	0.10
R8326:Cubn	UTSW	2	13306463	missense	probably benign	0.01
R8331:Cubn	UTSW	2	13340242	missense	probably damaging	1.00
R8338:Cubn	UTSW	2	13430847	missense	probably benign	0.08
R8341:Cubn	UTSW	2	13428724	missense	probably damaging	1.00
R8358:Cubn	UTSW	2	13325160	missense	probably benign	0.17
R8427:Cubn	UTSW	2	13428756	missense	probably benign	0.00
R8432:Cubn	UTSW	2	13381799	missense	probably benign	0.00
R8441:Cubn	UTSW	2	13427847	missense	probably damaging	1.00
R8442:Cubn	UTSW	2	13314044	missense	probably damaging	1.00
R8520:Cubn	UTSW	2	13308520	critical splice donor site	probably null
X0018:Cubn	UTSW	2	13458986	missense	probably damaging	1.00
X0022:Cubn	UTSW	2	13476076	missense	probably damaging	1.00
X0026:Cubn	UTSW	2	13342581	missense	probably damaging	1.00
X0063:Cubn	UTSW	2	13322962	missense	probably damaging	1.00
YA93:Cubn	UTSW	2	13383992	missense	probably benign	0.21
Z1088:Cubn	UTSW	2	13294229	missense	probably benign	0.43
Z1176:Cubn	UTSW	2	13381825	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CATCTGTGGTCCAAGGAATGTC -3'
(R):5'- ACTTTGGTTCCCAGGAAAACC -3'

Sequencing Primer
(F):5'- GAATGTCTTCCATACCTGCCTGG -3'
(R):5'- GCATCCTGGTCCTCTAAAATGCAG -3'

Posted On

2019-06-07