Mutagenetix > Incidental Mutations

Incidental Mutation 'PIT4354001:Spg11'

List |< first << previous [record 28 of 39] next >> last >|

554808

Institutional Source

Beutler Lab

Gene Symbol

Spg11

Ensembl Gene

ENSMUSG00000033396

Gene Name

SPG11, spatacsin vesicle trafficking associated

Synonyms

C530005A01Rik, 6030465E24Rik

Accession Numbers

Genbank: NM_145531

Is this an essential gene?

Probably non essential (E-score: 0.237) question?

Stock #

PIT4354001 (G1)

Quality Score

106.008

Status

Not validated

Chromosome

Chromosomal Location

122053520-122118386 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 122088185 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 988 (C988S)

Ref Sequence

ENSEMBL: ENSMUSP00000037543 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036450]

Predicted Effect

probably damaging
Transcript: ENSMUST00000036450
AA Change: C988S

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000037543
Gene: ENSMUSG00000033396
AA Change: C988S

Domain	Start	End	E-Value	Type
low complexity region	2	18	N/A	INTRINSIC
low complexity region	254	276	N/A	INTRINSIC
low complexity region	945	958	N/A	INTRINSIC
low complexity region	1250	1264	N/A	INTRINSIC
low complexity region	1305	1313	N/A	INTRINSIC
low complexity region	1673	1684	N/A	INTRINSIC
low complexity region	1772	1784	N/A	INTRINSIC
Pfam:Spatacsin_C	2082	2374	1.1e-105	PFAM

Coding Region Coverage

1x: 92.5%
3x: 90.1%
10x: 83.2%
20x: 69.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a potential transmembrane protein that is phosphorylated upon DNA damage. Defects in this gene are a cause of spastic paraplegia type 11 (SPG11). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a knock-out allele develop a progressive spastic and ataxic gait disorder and show loss of cortical motoneurons and Purkinje cells, a reduced number of lysosomes available for fusion with autophagosomes in degenerating neurons, and accumulation of autolysosome-derived material. [provided by MGI curators]

Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arap2	A	T	5: 62,654,049	Y1140N	probably damaging	Het
Ccdc83	A	T	7: 90,223,974	M391K	probably benign	Het
Cntnap1	A	T	11: 101,181,297	I459F	probably damaging	Het
Cr2	T	A	1: 195,166,309	Y302F	probably damaging	Het
Ctu2	A	T	8: 122,478,975	D179V	probably damaging	Het
Cubn	G	A	2: 13,468,852	Q427*	probably null	Het
Depdc7	A	G	2: 104,728,188	S163P	probably benign	Het
Eif2s3y	C	T	Y: 1,020,126	R385C	probably benign	Het
Gigyf1	A	G	5: 137,524,104	K728R	unknown	Het
Gm1587	G	A	14: 77,797,033	R32*	probably null	Het
Gm17689	T	A	9: 36,581,301	S103C	possibly damaging	Het
Hfe2	T	C	3: 96,528,445	C340R	probably damaging	Het
Isy1	A	G	6: 87,833,671	I53T	possibly damaging	Het
Myh8	A	T	11: 67,289,630	N564I	probably benign	Het
Neb	A	T	2: 52,245,318	I3260N	probably damaging	Het
Npc1	C	T	18: 12,211,535	G426E	probably benign	Het
Nrd1	G	A	4: 109,054,025		probably null	Het
Olfr1221	C	A	2: 89,112,486	E9*	probably null	Het
Olfr1257	T	A	2: 89,881,508	S227R	probably benign	Het
Olfr56	G	A	11: 49,134,305	V38M	probably damaging	Het
Prss51	T	A	14: 64,097,097	V91D	probably damaging	Het
Qpct	A	C	17: 79,081,759	Y280S	probably benign	Het
Rbpms	A	G	8: 33,806,838	V137A	possibly damaging	Het
Rgl2	T	A	17: 33,933,940	M441K	possibly damaging	Het
Sdhaf3	A	T	6: 6,956,072	I16F	possibly damaging	Het
Slc38a3	T	G	9: 107,657,649	N176H	probably benign	Het
Sos1	T	C	17: 80,449,356	S256G	possibly damaging	Het
Sync	A	T	4: 129,306,654	Q451L	possibly damaging	Het
Tbc1d31	A	G	15: 57,967,933	Y929C	probably benign	Het
Thbs2	G	A	17: 14,689,968	T123I	probably damaging	Het
Thsd7a	A	C	6: 12,331,927		probably null	Het
Tnfrsf11a	T	C	1: 105,821,517	L220P	probably damaging	Het
Trbv13-2	G	A	6: 41,121,818	C109Y	probably damaging	Het
Ugt3a1	G	A	15: 9,306,360	W198*	probably null	Het
Usp14	G	A	18: 9,996,189	R464W	probably damaging	Het
Vmn1r2	C	T	4: 3,172,162	S27L	probably benign	Het
Vmn1r68	T	A	7: 10,528,031	N47Y	probably benign	Het
Zfc3h1	T	A	10: 115,427,039	Y1719*	probably null	Het

Other mutations in Spg11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00426:Spg11	APN	2	122065560	missense	probably damaging	0.96
IGL00495:Spg11	APN	2	122094456	critical splice donor site	probably null
IGL00757:Spg11	APN	2	122070959	missense	probably benign	0.05
IGL01304:Spg11	APN	2	122072290	missense	probably damaging	1.00
IGL01355:Spg11	APN	2	122113156	missense	probably benign
IGL01626:Spg11	APN	2	122060971	missense	probably damaging	0.98
IGL01739:Spg11	APN	2	122114671	missense	probably damaging	1.00
IGL01835:Spg11	APN	2	122088224	missense	probably benign	0.36
IGL02129:Spg11	APN	2	122095686	missense	probably damaging	0.99
IGL02178:Spg11	APN	2	122097302	missense	probably damaging	1.00
IGL02199:Spg11	APN	2	122059553	missense	probably damaging	1.00
IGL02212:Spg11	APN	2	122108157	missense	probably benign	0.31
IGL02605:Spg11	APN	2	122092260	missense	probably benign	0.00
IGL02635:Spg11	APN	2	122113068	missense	possibly damaging	0.52
IGL02743:Spg11	APN	2	122059507	missense	probably damaging	0.97
IGL02822:Spg11	APN	2	122074534	missense	probably damaging	0.99
IGL02992:Spg11	APN	2	122058398	missense	probably damaging	1.00
IGL03010:Spg11	APN	2	122088320	missense	probably damaging	0.96
3-1:Spg11	UTSW	2	122086890	missense	probably damaging	0.98
R0131:Spg11	UTSW	2	122070968	missense	probably damaging	1.00
R0206:Spg11	UTSW	2	122055696	critical splice donor site	probably null
R0208:Spg11	UTSW	2	122055696	critical splice donor site	probably null
R0302:Spg11	UTSW	2	122092187	missense	possibly damaging	0.90
R0347:Spg11	UTSW	2	122097369	missense	probably damaging	0.99
R0357:Spg11	UTSW	2	122066232	splice site	probably benign
R0372:Spg11	UTSW	2	122059447	frame shift	probably null
R0715:Spg11	UTSW	2	122084983	missense	probably benign	0.03
R0927:Spg11	UTSW	2	122094487	missense	probably damaging	0.99
R1163:Spg11	UTSW	2	122070941	missense	probably damaging	1.00
R1534:Spg11	UTSW	2	122092325	missense	probably damaging	1.00
R1555:Spg11	UTSW	2	122097377	missense	probably damaging	0.99
R1569:Spg11	UTSW	2	122101706	missense	probably damaging	0.99
R1840:Spg11	UTSW	2	122101756	missense	probably damaging	1.00
R1929:Spg11	UTSW	2	122060207	missense	probably damaging	1.00
R2265:Spg11	UTSW	2	122108307	missense	possibly damaging	0.48
R2303:Spg11	UTSW	2	122068837	missense	probably damaging	0.99
R2510:Spg11	UTSW	2	122075310	missense	probably benign	0.03
R2760:Spg11	UTSW	2	122097359	missense	probably damaging	0.99
R2918:Spg11	UTSW	2	122075301	missense	probably damaging	0.99
R3195:Spg11	UTSW	2	122083398	critical splice donor site	probably null
R3423:Spg11	UTSW	2	122071053	missense	probably benign	0.00
R4353:Spg11	UTSW	2	122113194	missense	possibly damaging	0.92
R4407:Spg11	UTSW	2	122075332	missense	probably benign	0.00
R4644:Spg11	UTSW	2	122061029	missense	probably benign	0.03
R4663:Spg11	UTSW	2	122098099	critical splice donor site	probably null
R4684:Spg11	UTSW	2	122065076	missense	probably damaging	1.00
R4771:Spg11	UTSW	2	122065482	nonsense	probably null
R4810:Spg11	UTSW	2	122059796	missense	probably damaging	1.00
R4829:Spg11	UTSW	2	122108455	missense	probably benign	0.44
R5089:Spg11	UTSW	2	122114717	nonsense	probably null
R5362:Spg11	UTSW	2	122061000	missense	probably damaging	0.99
R5684:Spg11	UTSW	2	122093503	missense	probably damaging	1.00
R5899:Spg11	UTSW	2	122098199	missense	possibly damaging	0.67
R5923:Spg11	UTSW	2	122093478	missense	probably damaging	0.98
R6052:Spg11	UTSW	2	122097356	missense	probably damaging	0.99
R6111:Spg11	UTSW	2	122093482	missense	probably damaging	0.98
R6174:Spg11	UTSW	2	122086805	splice site	probably null
R6226:Spg11	UTSW	2	122088262	missense	possibly damaging	0.69
R6336:Spg11	UTSW	2	122112959	splice site	probably null
R6480:Spg11	UTSW	2	122092305	missense	probably benign	0.03
R6494:Spg11	UTSW	2	122113225	missense	probably damaging	0.98
R6582:Spg11	UTSW	2	122092292	missense	probably damaging	0.99
R6714:Spg11	UTSW	2	122095731	missense	probably damaging	0.99
R6791:Spg11	UTSW	2	122093443	missense	probably damaging	0.99
R6836:Spg11	UTSW	2	122059535	missense	probably damaging	1.00
R6928:Spg11	UTSW	2	122069904	missense	probably benign	0.37
R7179:Spg11	UTSW	2	122101789	splice site	probably null
R7229:Spg11	UTSW	2	122108104	missense	probably damaging	0.98
R7337:Spg11	UTSW	2	122084993	missense	probably benign	0.09
R7338:Spg11	UTSW	2	122055377	missense	probably damaging	1.00
R7351:Spg11	UTSW	2	122069931	missense	possibly damaging	0.95
R7378:Spg11	UTSW	2	122058429	missense	probably damaging	1.00
R7448:Spg11	UTSW	2	122093545	critical splice acceptor site	probably null
R7505:Spg11	UTSW	2	122075351	nonsense	probably null
R7665:Spg11	UTSW	2	122066267	missense	probably damaging	0.99
R7685:Spg11	UTSW	2	122068880	missense	probably damaging	0.99
R7779:Spg11	UTSW	2	122070939	missense	probably damaging	1.00
R7947:Spg11	UTSW	2	122092322	missense	probably damaging	1.00
R7958:Spg11	UTSW	2	122092945	splice site	probably null
R8024:Spg11	UTSW	2	122097321	missense	possibly damaging	0.67
R8033:Spg11	UTSW	2	122086951	missense	probably damaging	1.00
R8069:Spg11	UTSW	2	122113156	missense	probably benign
R8121:Spg11	UTSW	2	122069867	critical splice donor site	probably null
R8252:Spg11	UTSW	2	122088339	splice site	probably benign
R8358:Spg11	UTSW	2	122080258	missense	possibly damaging	0.69
R8362:Spg11	UTSW	2	122118361	missense	unknown
R8385:Spg11	UTSW	2	122097321	missense	probably benign	0.22
R8406:Spg11	UTSW	2	122093442	missense	probably damaging	0.99
R8480:Spg11	UTSW	2	122113079	missense	probably damaging	1.00
Z1177:Spg11	UTSW	2	122072985	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TTCTCAAAGCAGTTCAGGGG -3'
(R):5'- GTGTGTCTGATTTGAACCTCACAC -3'

Sequencing Primer
(F):5'- CTGTCTACACAGTGAGTTCCAGAG -3'
(R):5'- GTCTGATTTGAACCTCACACTTCTTC -3'

Posted On

2019-06-07