Incidental Mutation 'PIT4354001:Vmn1r2'
ID554810
Institutional Source Beutler Lab
Gene Symbol Vmn1r2
Ensembl Gene ENSMUSG00000115072
Gene Namevomeronasal 1 receptor 2
SynonymsGm11776
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.796) question?
Stock #PIT4354001 (G1)
Quality Score168.009
Status Not validated
Chromosome4
Chromosomal Location3167320-3173006 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 3172162 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 27 (S27L)
Ref Sequence ENSEMBL: ENSMUSP00000100791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105160] [ENSMUST00000226198]
Predicted Effect probably benign
Transcript: ENSMUST00000105160
AA Change: S27L

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000100791
Gene: ENSMUSG00000115072
AA Change: S27L

DomainStartEndE-ValueType
Pfam:TAS2R 7 302 2.7e-8 PFAM
Pfam:V1R 30 298 6.3e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226198
AA Change: S27L

PolyPhen 2 Score 0.228 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 92.5%
  • 3x: 90.1%
  • 10x: 83.2%
  • 20x: 69.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap2 A T 5: 62,654,049 Y1140N probably damaging Het
Ccdc83 A T 7: 90,223,974 M391K probably benign Het
Cntnap1 A T 11: 101,181,297 I459F probably damaging Het
Cr2 T A 1: 195,166,309 Y302F probably damaging Het
Ctu2 A T 8: 122,478,975 D179V probably damaging Het
Cubn G A 2: 13,468,852 Q427* probably null Het
Depdc7 A G 2: 104,728,188 S163P probably benign Het
Eif2s3y C T Y: 1,020,126 R385C probably benign Het
Gigyf1 A G 5: 137,524,104 K728R unknown Het
Gm1587 G A 14: 77,797,033 R32* probably null Het
Gm17689 T A 9: 36,581,301 S103C possibly damaging Het
Hfe2 T C 3: 96,528,445 C340R probably damaging Het
Isy1 A G 6: 87,833,671 I53T possibly damaging Het
Myh8 A T 11: 67,289,630 N564I probably benign Het
Neb A T 2: 52,245,318 I3260N probably damaging Het
Npc1 C T 18: 12,211,535 G426E probably benign Het
Nrd1 G A 4: 109,054,025 probably null Het
Olfr1221 C A 2: 89,112,486 E9* probably null Het
Olfr1257 T A 2: 89,881,508 S227R probably benign Het
Olfr56 G A 11: 49,134,305 V38M probably damaging Het
Prss51 T A 14: 64,097,097 V91D probably damaging Het
Qpct A C 17: 79,081,759 Y280S probably benign Het
Rbpms A G 8: 33,806,838 V137A possibly damaging Het
Rgl2 T A 17: 33,933,940 M441K possibly damaging Het
Sdhaf3 A T 6: 6,956,072 I16F possibly damaging Het
Slc38a3 T G 9: 107,657,649 N176H probably benign Het
Sos1 T C 17: 80,449,356 S256G possibly damaging Het
Spg11 A T 2: 122,088,185 C988S probably damaging Het
Sync A T 4: 129,306,654 Q451L possibly damaging Het
Tbc1d31 A G 15: 57,967,933 Y929C probably benign Het
Thbs2 G A 17: 14,689,968 T123I probably damaging Het
Thsd7a A C 6: 12,331,927 probably null Het
Tnfrsf11a T C 1: 105,821,517 L220P probably damaging Het
Trbv13-2 G A 6: 41,121,818 C109Y probably damaging Het
Ugt3a1 G A 15: 9,306,360 W198* probably null Het
Usp14 G A 18: 9,996,189 R464W probably damaging Het
Vmn1r68 T A 7: 10,528,031 N47Y probably benign Het
Zfc3h1 T A 10: 115,427,039 Y1719* probably null Het
Other mutations in Vmn1r2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00328:Vmn1r2 APN 4 3172807 missense probably damaging 0.98
PIT4151001:Vmn1r2 UTSW 4 3172623 missense probably benign 0.00
R1836:Vmn1r2 UTSW 4 3172836 missense probably damaging 1.00
R1855:Vmn1r2 UTSW 4 3172588 missense probably damaging 1.00
R2319:Vmn1r2 UTSW 4 3172083 start codon destroyed probably null 0.02
R3414:Vmn1r2 UTSW 4 3172696 missense probably damaging 1.00
R3824:Vmn1r2 UTSW 4 3172413 missense probably damaging 1.00
R5654:Vmn1r2 UTSW 4 3172261 missense probably benign 0.17
R7084:Vmn1r2 UTSW 4 3172134 missense probably benign 0.44
R7661:Vmn1r2 UTSW 4 3172149 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTGCCAGCATAGACAAGGG -3'
(R):5'- CAACTCAGTAGGCACAGAGC -3'

Sequencing Primer
(F):5'- CACCTTTTTGCAGTGAGAGAAC -3'
(R):5'- CCCCTTGTTATTCGGGAAATATACAC -3'
Posted On2019-06-07