Incidental Mutation 'PIT4354001:Nrd1'
ID554811
Institutional Source Beutler Lab
Gene Symbol Nrd1
Ensembl Gene ENSMUSG00000053510
Gene Namenardilysin, N-arginine dibasic convertase, NRD convertase 1
SynonymsNRD-C
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #PIT4354001 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location109000655-109061777 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 109054025 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000068328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065977] [ENSMUST00000102736] [ENSMUST00000106644]
Predicted Effect probably null
Transcript: ENSMUST00000065977
SMART Domains Protein: ENSMUSP00000068328
Gene: ENSMUSG00000053510

DomainStartEndE-ValueType
low complexity region 139 165 N/A INTRINSIC
low complexity region 172 209 N/A INTRINSIC
Pfam:Peptidase_M16 210 348 1.1e-43 PFAM
Pfam:Peptidase_M16_C 373 559 2.3e-22 PFAM
Pfam:Peptidase_M16_C 849 1032 1.5e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102736
SMART Domains Protein: ENSMUSP00000099797
Gene: ENSMUSG00000053510

DomainStartEndE-ValueType
low complexity region 139 165 N/A INTRINSIC
low complexity region 172 209 N/A INTRINSIC
Pfam:Peptidase_M16 210 348 1.4e-43 PFAM
Pfam:Peptidase_M16_C 400 515 1.1e-9 PFAM
Pfam:Peptidase_M16_C 805 988 2e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106644
SMART Domains Protein: ENSMUSP00000102255
Gene: ENSMUSG00000053510

DomainStartEndE-ValueType
low complexity region 139 165 N/A INTRINSIC
coiled coil region 187 225 N/A INTRINSIC
Pfam:Peptidase_M16 281 416 1e-41 PFAM
Pfam:Peptidase_M16_C 441 627 2.2e-23 PFAM
Pfam:Peptidase_M16_M 631 913 1e-91 PFAM
Pfam:Peptidase_M16_C 917 1100 6e-15 PFAM
Coding Region Coverage
  • 1x: 92.5%
  • 3x: 90.1%
  • 10x: 83.2%
  • 20x: 69.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc-dependent endopeptidase that cleaves peptide substrates at the N-terminus of arginine residues in dibasic moieties and is a member of the peptidase M16 family. This protein interacts with heparin-binding EGF-like growth factor and plays a role in cell migration and proliferation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a knock-out allele mostly die within 48 hours of birth with surviving mice exhibiting cortical thinning, enlarged lateral ventricles, hypomyelination, reduced grip strength, impaired coordination, and impaired spatial working memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap2 A T 5: 62,654,049 Y1140N probably damaging Het
Ccdc83 A T 7: 90,223,974 M391K probably benign Het
Cntnap1 A T 11: 101,181,297 I459F probably damaging Het
Cr2 T A 1: 195,166,309 Y302F probably damaging Het
Ctu2 A T 8: 122,478,975 D179V probably damaging Het
Cubn G A 2: 13,468,852 Q427* probably null Het
Depdc7 A G 2: 104,728,188 S163P probably benign Het
Eif2s3y C T Y: 1,020,126 R385C probably benign Het
Gigyf1 A G 5: 137,524,104 K728R unknown Het
Gm1587 G A 14: 77,797,033 R32* probably null Het
Gm17689 T A 9: 36,581,301 S103C possibly damaging Het
Hfe2 T C 3: 96,528,445 C340R probably damaging Het
Isy1 A G 6: 87,833,671 I53T possibly damaging Het
Myh8 A T 11: 67,289,630 N564I probably benign Het
Neb A T 2: 52,245,318 I3260N probably damaging Het
Npc1 C T 18: 12,211,535 G426E probably benign Het
Olfr1221 C A 2: 89,112,486 E9* probably null Het
Olfr1257 T A 2: 89,881,508 S227R probably benign Het
Olfr56 G A 11: 49,134,305 V38M probably damaging Het
Prss51 T A 14: 64,097,097 V91D probably damaging Het
Qpct A C 17: 79,081,759 Y280S probably benign Het
Rbpms A G 8: 33,806,838 V137A possibly damaging Het
Rgl2 T A 17: 33,933,940 M441K possibly damaging Het
Sdhaf3 A T 6: 6,956,072 I16F possibly damaging Het
Slc38a3 T G 9: 107,657,649 N176H probably benign Het
Sos1 T C 17: 80,449,356 S256G possibly damaging Het
Spg11 A T 2: 122,088,185 C988S probably damaging Het
Sync A T 4: 129,306,654 Q451L possibly damaging Het
Tbc1d31 A G 15: 57,967,933 Y929C probably benign Het
Thbs2 G A 17: 14,689,968 T123I probably damaging Het
Thsd7a A C 6: 12,331,927 probably null Het
Tnfrsf11a T C 1: 105,821,517 L220P probably damaging Het
Trbv13-2 G A 6: 41,121,818 C109Y probably damaging Het
Ugt3a1 G A 15: 9,306,360 W198* probably null Het
Usp14 G A 18: 9,996,189 R464W probably damaging Het
Vmn1r2 C T 4: 3,172,162 S27L probably benign Het
Vmn1r68 T A 7: 10,528,031 N47Y probably benign Het
Zfc3h1 T A 10: 115,427,039 Y1719* probably null Het
Other mutations in Nrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Nrd1 APN 4 109046687 unclassified probably benign
IGL00857:Nrd1 APN 4 109054002 missense probably damaging 1.00
IGL01417:Nrd1 APN 4 109000830 utr 5 prime probably benign
IGL01457:Nrd1 APN 4 109047660 missense probably benign 0.03
IGL02112:Nrd1 APN 4 109027432 splice site probably benign
IGL02279:Nrd1 APN 4 109024194 splice site probably benign
IGL02332:Nrd1 APN 4 109000988 missense probably damaging 0.99
IGL02890:Nrd1 APN 4 109053919 missense possibly damaging 0.55
IGL03179:Nrd1 APN 4 109046691 unclassified probably benign
R0551:Nrd1 UTSW 4 109047708 missense probably damaging 1.00
R1468:Nrd1 UTSW 4 109016668 missense probably benign 0.01
R1468:Nrd1 UTSW 4 109016668 missense probably benign 0.01
R1990:Nrd1 UTSW 4 109039775 nonsense probably null
R4391:Nrd1 UTSW 4 109046644 missense probably damaging 1.00
R4994:Nrd1 UTSW 4 109046612 missense probably benign
R5164:Nrd1 UTSW 4 109039717 missense probably damaging 0.99
R5229:Nrd1 UTSW 4 109049108 missense probably damaging 1.00
R5387:Nrd1 UTSW 4 109039762 missense probably damaging 1.00
R5530:Nrd1 UTSW 4 109047609 missense probably damaging 0.96
R5672:Nrd1 UTSW 4 109038045 nonsense probably null
R5990:Nrd1 UTSW 4 109019071 missense probably damaging 1.00
R6018:Nrd1 UTSW 4 109013747 missense probably benign 0.01
R6106:Nrd1 UTSW 4 109044585 missense probably damaging 0.99
R6114:Nrd1 UTSW 4 109044585 missense probably damaging 0.99
R6140:Nrd1 UTSW 4 109049111 missense probably damaging 0.97
R6285:Nrd1 UTSW 4 109038006 missense probably damaging 0.99
R6824:Nrd1 UTSW 4 109043425 missense probably damaging 1.00
R7019:Nrd1 UTSW 4 109028802 missense probably benign 0.33
R7353:Nrd1 UTSW 4 109039749 missense probably damaging 1.00
R7735:Nrd1 UTSW 4 109037985 missense probably damaging 1.00
R8261:Nrd1 UTSW 4 109016679 missense possibly damaging 0.67
R8340:Nrd1 UTSW 4 109001154 missense probably damaging 1.00
R8352:Nrd1 UTSW 4 109019063 missense probably damaging 0.98
R8368:Nrd1 UTSW 4 109013698 missense probably benign 0.02
R8452:Nrd1 UTSW 4 109019063 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGCATTTCCTCCCTCAGGTTTAG -3'
(R):5'- CTGATTCAGACACATGTGCCC -3'

Sequencing Primer
(F):5'- CCTCCCTCAGGTTTAGTATATTTCC -3'
(R):5'- GTGCCCATGTAAGCTGCGATTAAC -3'
Posted On2019-06-07