Mutagenetix > Incidental Mutations

Incidental Mutation 'PIT4354001:Nrd1'

List |< first << previous [record 17 of 39] next >> last >|

554811

Institutional Source

Beutler Lab

Gene Symbol

Nrd1

Ensembl Gene

ENSMUSG00000053510

Gene Name

nardilysin, N-arginine dibasic convertase, NRD convertase 1

Synonyms

NRD-C

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.144) question?

Stock #

PIT4354001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

109000655-109061777 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

G to A at 109054025 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000068328 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065977] [ENSMUST00000102736] [ENSMUST00000106644]

Predicted Effect

probably null
Transcript: ENSMUST00000065977

SMART Domains

Protein: ENSMUSP00000068328
Gene: ENSMUSG00000053510

Domain	Start	End	E-Value	Type
low complexity region	139	165	N/A	INTRINSIC
low complexity region	172	209	N/A	INTRINSIC
Pfam:Peptidase_M16	210	348	1.1e-43	PFAM
Pfam:Peptidase_M16_C	373	559	2.3e-22	PFAM
Pfam:Peptidase_M16_C	849	1032	1.5e-14	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000102736

SMART Domains

Protein: ENSMUSP00000099797
Gene: ENSMUSG00000053510

Domain	Start	End	E-Value	Type
low complexity region	139	165	N/A	INTRINSIC
low complexity region	172	209	N/A	INTRINSIC
Pfam:Peptidase_M16	210	348	1.4e-43	PFAM
Pfam:Peptidase_M16_C	400	515	1.1e-9	PFAM
Pfam:Peptidase_M16_C	805	988	2e-14	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000106644

SMART Domains

Protein: ENSMUSP00000102255
Gene: ENSMUSG00000053510

Domain	Start	End	E-Value	Type
low complexity region	139	165	N/A	INTRINSIC
coiled coil region	187	225	N/A	INTRINSIC
Pfam:Peptidase_M16	281	416	1e-41	PFAM
Pfam:Peptidase_M16_C	441	627	2.2e-23	PFAM
Pfam:Peptidase_M16_M	631	913	1e-91	PFAM
Pfam:Peptidase_M16_C	917	1100	6e-15	PFAM

Coding Region Coverage

1x: 92.5%
3x: 90.1%
10x: 83.2%
20x: 69.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc-dependent endopeptidase that cleaves peptide substrates at the N-terminus of arginine residues in dibasic moieties and is a member of the peptidase M16 family. This protein interacts with heparin-binding EGF-like growth factor and plays a role in cell migration and proliferation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a knock-out allele mostly die within 48 hours of birth with surviving mice exhibiting cortical thinning, enlarged lateral ventricles, hypomyelination, reduced grip strength, impaired coordination, and impaired spatial working memory. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arap2	A	T	5: 62,654,049	Y1140N	probably damaging	Het
Ccdc83	A	T	7: 90,223,974	M391K	probably benign	Het
Cntnap1	A	T	11: 101,181,297	I459F	probably damaging	Het
Cr2	T	A	1: 195,166,309	Y302F	probably damaging	Het
Ctu2	A	T	8: 122,478,975	D179V	probably damaging	Het
Cubn	G	A	2: 13,468,852	Q427*	probably null	Het
Depdc7	A	G	2: 104,728,188	S163P	probably benign	Het
Eif2s3y	C	T	Y: 1,020,126	R385C	probably benign	Het
Gigyf1	A	G	5: 137,524,104	K728R	unknown	Het
Gm1587	G	A	14: 77,797,033	R32*	probably null	Het
Gm17689	T	A	9: 36,581,301	S103C	possibly damaging	Het
Hfe2	T	C	3: 96,528,445	C340R	probably damaging	Het
Isy1	A	G	6: 87,833,671	I53T	possibly damaging	Het
Myh8	A	T	11: 67,289,630	N564I	probably benign	Het
Neb	A	T	2: 52,245,318	I3260N	probably damaging	Het
Npc1	C	T	18: 12,211,535	G426E	probably benign	Het
Olfr1221	C	A	2: 89,112,486	E9*	probably null	Het
Olfr1257	T	A	2: 89,881,508	S227R	probably benign	Het
Olfr56	G	A	11: 49,134,305	V38M	probably damaging	Het
Prss51	T	A	14: 64,097,097	V91D	probably damaging	Het
Qpct	A	C	17: 79,081,759	Y280S	probably benign	Het
Rbpms	A	G	8: 33,806,838	V137A	possibly damaging	Het
Rgl2	T	A	17: 33,933,940	M441K	possibly damaging	Het
Sdhaf3	A	T	6: 6,956,072	I16F	possibly damaging	Het
Slc38a3	T	G	9: 107,657,649	N176H	probably benign	Het
Sos1	T	C	17: 80,449,356	S256G	possibly damaging	Het
Spg11	A	T	2: 122,088,185	C988S	probably damaging	Het
Sync	A	T	4: 129,306,654	Q451L	possibly damaging	Het
Tbc1d31	A	G	15: 57,967,933	Y929C	probably benign	Het
Thbs2	G	A	17: 14,689,968	T123I	probably damaging	Het
Thsd7a	A	C	6: 12,331,927		probably null	Het
Tnfrsf11a	T	C	1: 105,821,517	L220P	probably damaging	Het
Trbv13-2	G	A	6: 41,121,818	C109Y	probably damaging	Het
Ugt3a1	G	A	15: 9,306,360	W198*	probably null	Het
Usp14	G	A	18: 9,996,189	R464W	probably damaging	Het
Vmn1r2	C	T	4: 3,172,162	S27L	probably benign	Het
Vmn1r68	T	A	7: 10,528,031	N47Y	probably benign	Het
Zfc3h1	T	A	10: 115,427,039	Y1719*	probably null	Het

Other mutations in Nrd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00577:Nrd1	APN	4	109046687	unclassified	probably benign
IGL00857:Nrd1	APN	4	109054002	missense	probably damaging	1.00
IGL01417:Nrd1	APN	4	109000830	utr 5 prime	probably benign
IGL01457:Nrd1	APN	4	109047660	missense	probably benign	0.03
IGL02112:Nrd1	APN	4	109027432	splice site	probably benign
IGL02279:Nrd1	APN	4	109024194	splice site	probably benign
IGL02332:Nrd1	APN	4	109000988	missense	probably damaging	0.99
IGL02890:Nrd1	APN	4	109053919	missense	possibly damaging	0.55
IGL03179:Nrd1	APN	4	109046691	unclassified	probably benign
R0551:Nrd1	UTSW	4	109047708	missense	probably damaging	1.00
R1468:Nrd1	UTSW	4	109016668	missense	probably benign	0.01
R1468:Nrd1	UTSW	4	109016668	missense	probably benign	0.01
R1990:Nrd1	UTSW	4	109039775	nonsense	probably null
R4391:Nrd1	UTSW	4	109046644	missense	probably damaging	1.00
R4994:Nrd1	UTSW	4	109046612	missense	probably benign
R5164:Nrd1	UTSW	4	109039717	missense	probably damaging	0.99
R5229:Nrd1	UTSW	4	109049108	missense	probably damaging	1.00
R5387:Nrd1	UTSW	4	109039762	missense	probably damaging	1.00
R5530:Nrd1	UTSW	4	109047609	missense	probably damaging	0.96
R5672:Nrd1	UTSW	4	109038045	nonsense	probably null
R5990:Nrd1	UTSW	4	109019071	missense	probably damaging	1.00
R6018:Nrd1	UTSW	4	109013747	missense	probably benign	0.01
R6106:Nrd1	UTSW	4	109044585	missense	probably damaging	0.99
R6114:Nrd1	UTSW	4	109044585	missense	probably damaging	0.99
R6140:Nrd1	UTSW	4	109049111	missense	probably damaging	0.97
R6285:Nrd1	UTSW	4	109038006	missense	probably damaging	0.99
R6824:Nrd1	UTSW	4	109043425	missense	probably damaging	1.00
R7019:Nrd1	UTSW	4	109028802	missense	probably benign	0.33
R7353:Nrd1	UTSW	4	109039749	missense	probably damaging	1.00
R7735:Nrd1	UTSW	4	109037985	missense	probably damaging	1.00
R8261:Nrd1	UTSW	4	109016679	missense	possibly damaging	0.67
R8340:Nrd1	UTSW	4	109001154	missense	probably damaging	1.00
R8352:Nrd1	UTSW	4	109019063	missense	probably damaging	0.98
R8368:Nrd1	UTSW	4	109013698	missense	probably benign	0.02
R8452:Nrd1	UTSW	4	109019063	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AAGCATTTCCTCCCTCAGGTTTAG -3'
(R):5'- CTGATTCAGACACATGTGCCC -3'

Sequencing Primer
(F):5'- CCTCCCTCAGGTTTAGTATATTTCC -3'
(R):5'- GTGCCCATGTAAGCTGCGATTAAC -3'

Posted On

2019-06-07