Incidental Mutation 'PIT4354001:Sync'
List |< first << previous [record 29 of 39] next >> last >|
ID554812
Institutional Source Beutler Lab
Gene Symbol Sync
Ensembl Gene ENSMUSG00000001333
Gene Namesyncoilin
Synonyms1110057H03Rik, SNIP4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #PIT4354001 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location129287617-129308559 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 129306654 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 451 (Q451L)
Ref Sequence ENSEMBL: ENSMUSP00000099659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102598] [ENSMUST00000102599]
Predicted Effect probably benign
Transcript: ENSMUST00000102598
SMART Domains Protein: ENSMUSP00000099658
Gene: ENSMUSG00000057236

DomainStartEndE-ValueType
Pfam:CAF1C_H4-bd 19 88 1.3e-28 PFAM
WD40 112 153 8.25e0 SMART
WD40 166 206 2.07e-6 SMART
WD40 216 256 4.48e-2 SMART
WD40 262 302 5.81e-10 SMART
WD40 306 346 3.93e-7 SMART
WD40 363 403 1.08e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102599
AA Change: Q451L

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099659
Gene: ENSMUSG00000001333
AA Change: Q451L

DomainStartEndE-ValueType
low complexity region 65 75 N/A INTRINSIC
Filament 156 453 1.2e-2 SMART
Coding Region Coverage
  • 1x: 92.5%
  • 3x: 90.1%
  • 10x: 83.2%
  • 20x: 69.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the intermediate filament family which contains an N-terminal head domain, followed by a central coiled-coil region and a short C-terminal tail. The protein is highly expressed in skeletal and cardiac muscle. The protein links the dystrophin associated protein complex (DAPC) to desmin filaments in muscle and may have a structural role in striated muscle. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2009]
PHENOTYPE: Homozygotes for one knock-out allele show reduced generation of isometric stress in skeletal muscle but a normal response to eccentric contraction-induced injury. Homozygotes for another knock-out allele show impaired contractility and increased skeletalmuscle damage under a forced exercise regime. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap2 A T 5: 62,654,049 Y1140N probably damaging Het
Ccdc83 A T 7: 90,223,974 M391K probably benign Het
Cntnap1 A T 11: 101,181,297 I459F probably damaging Het
Cr2 T A 1: 195,166,309 Y302F probably damaging Het
Ctu2 A T 8: 122,478,975 D179V probably damaging Het
Cubn G A 2: 13,468,852 Q427* probably null Het
Depdc7 A G 2: 104,728,188 S163P probably benign Het
Eif2s3y C T Y: 1,020,126 R385C probably benign Het
Gigyf1 A G 5: 137,524,104 K728R unknown Het
Gm1587 G A 14: 77,797,033 R32* probably null Het
Gm17689 T A 9: 36,581,301 S103C possibly damaging Het
Hfe2 T C 3: 96,528,445 C340R probably damaging Het
Isy1 A G 6: 87,833,671 I53T possibly damaging Het
Myh8 A T 11: 67,289,630 N564I probably benign Het
Neb A T 2: 52,245,318 I3260N probably damaging Het
Npc1 C T 18: 12,211,535 G426E probably benign Het
Nrd1 G A 4: 109,054,025 probably null Het
Olfr1221 C A 2: 89,112,486 E9* probably null Het
Olfr1257 T A 2: 89,881,508 S227R probably benign Het
Olfr56 G A 11: 49,134,305 V38M probably damaging Het
Prss51 T A 14: 64,097,097 V91D probably damaging Het
Qpct A C 17: 79,081,759 Y280S probably benign Het
Rbpms A G 8: 33,806,838 V137A possibly damaging Het
Rgl2 T A 17: 33,933,940 M441K possibly damaging Het
Sdhaf3 A T 6: 6,956,072 I16F possibly damaging Het
Slc38a3 T G 9: 107,657,649 N176H probably benign Het
Sos1 T C 17: 80,449,356 S256G possibly damaging Het
Spg11 A T 2: 122,088,185 C988S probably damaging Het
Tbc1d31 A G 15: 57,967,933 Y929C probably benign Het
Thbs2 G A 17: 14,689,968 T123I probably damaging Het
Thsd7a A C 6: 12,331,927 probably null Het
Tnfrsf11a T C 1: 105,821,517 L220P probably damaging Het
Trbv13-2 G A 6: 41,121,818 C109Y probably damaging Het
Ugt3a1 G A 15: 9,306,360 W198* probably null Het
Usp14 G A 18: 9,996,189 R464W probably damaging Het
Vmn1r2 C T 4: 3,172,162 S27L probably benign Het
Vmn1r68 T A 7: 10,528,031 N47Y probably benign Het
Zfc3h1 T A 10: 115,427,039 Y1719* probably null Het
Other mutations in Sync
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02629:Sync APN 4 129293951 missense probably damaging 0.99
R0017:Sync UTSW 4 129293744 missense probably damaging 1.00
R0017:Sync UTSW 4 129293744 missense probably damaging 1.00
R0242:Sync UTSW 4 129293721 missense probably damaging 1.00
R0242:Sync UTSW 4 129293721 missense probably damaging 1.00
R0825:Sync UTSW 4 129293397 missense probably benign 0.04
R0846:Sync UTSW 4 129294104 missense probably benign 0.13
R3824:Sync UTSW 4 129294363 missense possibly damaging 0.95
R4151:Sync UTSW 4 129293726 nonsense probably null
R4166:Sync UTSW 4 129306742 intron probably benign
R4760:Sync UTSW 4 129293439 missense probably benign 0.01
R5753:Sync UTSW 4 129293386 nonsense probably null
R6120:Sync UTSW 4 129293751 missense probably damaging 1.00
R6578:Sync UTSW 4 129294267 missense probably damaging 1.00
R6860:Sync UTSW 4 129287790 critical splice donor site probably null
R7347:Sync UTSW 4 129294306 missense probably benign 0.22
R7612:Sync UTSW 4 129293582 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AGTGTTCTCTGCTTCCCAAG -3'
(R):5'- ACCAGCCAGTAGATGATGTAGC -3'

Sequencing Primer
(F):5'- GTCTCTCAAATCTAAAACTCAGAGG -3'
(R):5'- CTAAAAGTTCTTAGCTGGGCAG -3'
Posted On2019-06-07