Incidental Mutation 'PIT4354001:Gigyf1'
ID554814
Institutional Source Beutler Lab
Gene Symbol Gigyf1
Ensembl Gene ENSMUSG00000029714
Gene NameGRB10 interacting GYF protein 1
SynonymsPerq1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.493) question?
Stock #PIT4354001 (G1)
Quality Score172.116
Status Not validated
Chromosome5
Chromosomal Location137518548-137527935 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 137524104 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 728 (K728R)
Ref Sequence ENSEMBL: ENSMUSP00000031727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031726] [ENSMUST00000031727] [ENSMUST00000111020] [ENSMUST00000111023] [ENSMUST00000111027] [ENSMUST00000111038] [ENSMUST00000132525] [ENSMUST00000143495] [ENSMUST00000150063] [ENSMUST00000168746] [ENSMUST00000170293] [ENSMUST00000197624]
Predicted Effect probably benign
Transcript: ENSMUST00000031726
SMART Domains Protein: ENSMUSP00000031726
Gene: ENSMUSG00000029713

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
WD40 44 83 1.05e-7 SMART
WD40 86 125 3.96e-3 SMART
WD40 132 170 1.57e-6 SMART
WD40 173 212 2.98e-7 SMART
WD40 215 254 2.1e-7 SMART
WD40 257 298 1.72e-3 SMART
WD40 301 340 2.04e-5 SMART
Predicted Effect unknown
Transcript: ENSMUST00000031727
AA Change: K728R
SMART Domains Protein: ENSMUSP00000031727
Gene: ENSMUSG00000029714
AA Change: K728R

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
low complexity region 69 87 N/A INTRINSIC
low complexity region 114 129 N/A INTRINSIC
low complexity region 253 269 N/A INTRINSIC
low complexity region 323 352 N/A INTRINSIC
low complexity region 360 379 N/A INTRINSIC
coiled coil region 424 450 N/A INTRINSIC
GYF 477 532 1.6e-25 SMART
low complexity region 534 543 N/A INTRINSIC
low complexity region 553 576 N/A INTRINSIC
low complexity region 597 613 N/A INTRINSIC
coiled coil region 671 735 N/A INTRINSIC
low complexity region 748 759 N/A INTRINSIC
low complexity region 826 837 N/A INTRINSIC
low complexity region 848 877 N/A INTRINSIC
low complexity region 881 893 N/A INTRINSIC
coiled coil region 957 984 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111020
SMART Domains Protein: ENSMUSP00000106649
Gene: ENSMUSG00000029713

DomainStartEndE-ValueType
WD40 1 39 2.65e-4 SMART
WD40 42 81 3.96e-3 SMART
WD40 88 126 1.57e-6 SMART
WD40 129 168 2.98e-7 SMART
WD40 171 210 2.1e-7 SMART
WD40 213 254 1.72e-3 SMART
WD40 257 296 2.04e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111023
SMART Domains Protein: ENSMUSP00000106652
Gene: ENSMUSG00000029713

DomainStartEndE-ValueType
WD40 1 39 2.65e-4 SMART
WD40 42 81 3.96e-3 SMART
WD40 88 126 1.57e-6 SMART
WD40 129 168 2.98e-7 SMART
WD40 171 210 2.1e-7 SMART
WD40 213 254 1.72e-3 SMART
WD40 257 296 2.04e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111027
SMART Domains Protein: ENSMUSP00000106656
Gene: ENSMUSG00000029713

DomainStartEndE-ValueType
low complexity region 23 41 N/A INTRINSIC
low complexity region 45 59 N/A INTRINSIC
WD40 86 125 1.05e-7 SMART
WD40 128 167 3.96e-3 SMART
WD40 174 212 1.57e-6 SMART
WD40 215 254 2.98e-7 SMART
WD40 257 296 2.1e-7 SMART
WD40 299 340 1.72e-3 SMART
WD40 343 382 2.04e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111038
SMART Domains Protein: ENSMUSP00000106667
Gene: ENSMUSG00000029711

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:EPO_TPO 30 191 2.8e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132525
SMART Domains Protein: ENSMUSP00000119725
Gene: ENSMUSG00000029713

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
WD40 44 83 1.05e-7 SMART
WD40 86 125 3.96e-3 SMART
WD40 132 170 1.57e-6 SMART
WD40 173 212 2.98e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143495
SMART Domains Protein: ENSMUSP00000126823
Gene: ENSMUSG00000029713

DomainStartEndE-ValueType
Pfam:WD40 1 25 3.8e-3 PFAM
WD40 32 70 1.57e-6 SMART
WD40 73 112 2.98e-7 SMART
WD40 115 154 2.1e-7 SMART
WD40 157 198 1.72e-3 SMART
WD40 201 240 2.04e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150063
SMART Domains Protein: ENSMUSP00000129353
Gene: ENSMUSG00000029713

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
WD40 44 83 1.05e-7 SMART
WD40 86 125 3.96e-3 SMART
WD40 132 170 1.57e-6 SMART
WD40 173 212 2.98e-7 SMART
WD40 215 254 2.1e-7 SMART
WD40 257 298 1.72e-3 SMART
WD40 301 340 2.04e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168746
SMART Domains Protein: ENSMUSP00000132908
Gene: ENSMUSG00000029713

DomainStartEndE-ValueType
Pfam:WD40 1 25 3.8e-3 PFAM
WD40 32 70 1.57e-6 SMART
WD40 73 112 2.98e-7 SMART
WD40 115 154 2.1e-7 SMART
WD40 157 198 1.72e-3 SMART
WD40 201 240 2.04e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170293
SMART Domains Protein: ENSMUSP00000128038
Gene: ENSMUSG00000029713

DomainStartEndE-ValueType
WD40 1 39 2.65e-4 SMART
WD40 42 81 3.96e-3 SMART
WD40 88 126 1.57e-6 SMART
WD40 129 168 2.98e-7 SMART
WD40 171 210 2.1e-7 SMART
WD40 213 254 1.72e-3 SMART
WD40 257 296 2.04e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197624
SMART Domains Protein: ENSMUSP00000143670
Gene: ENSMUSG00000029714

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
low complexity region 69 87 N/A INTRINSIC
low complexity region 114 129 N/A INTRINSIC
Coding Region Coverage
  • 1x: 92.5%
  • 3x: 90.1%
  • 10x: 83.2%
  • 20x: 69.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap2 A T 5: 62,654,049 Y1140N probably damaging Het
Ccdc83 A T 7: 90,223,974 M391K probably benign Het
Cntnap1 A T 11: 101,181,297 I459F probably damaging Het
Cr2 T A 1: 195,166,309 Y302F probably damaging Het
Ctu2 A T 8: 122,478,975 D179V probably damaging Het
Cubn G A 2: 13,468,852 Q427* probably null Het
Depdc7 A G 2: 104,728,188 S163P probably benign Het
Eif2s3y C T Y: 1,020,126 R385C probably benign Het
Gm1587 G A 14: 77,797,033 R32* probably null Het
Gm17689 T A 9: 36,581,301 S103C possibly damaging Het
Hfe2 T C 3: 96,528,445 C340R probably damaging Het
Isy1 A G 6: 87,833,671 I53T possibly damaging Het
Myh8 A T 11: 67,289,630 N564I probably benign Het
Neb A T 2: 52,245,318 I3260N probably damaging Het
Npc1 C T 18: 12,211,535 G426E probably benign Het
Nrd1 G A 4: 109,054,025 probably null Het
Olfr1221 C A 2: 89,112,486 E9* probably null Het
Olfr1257 T A 2: 89,881,508 S227R probably benign Het
Olfr56 G A 11: 49,134,305 V38M probably damaging Het
Prss51 T A 14: 64,097,097 V91D probably damaging Het
Qpct A C 17: 79,081,759 Y280S probably benign Het
Rbpms A G 8: 33,806,838 V137A possibly damaging Het
Rgl2 T A 17: 33,933,940 M441K possibly damaging Het
Sdhaf3 A T 6: 6,956,072 I16F possibly damaging Het
Slc38a3 T G 9: 107,657,649 N176H probably benign Het
Sos1 T C 17: 80,449,356 S256G possibly damaging Het
Spg11 A T 2: 122,088,185 C988S probably damaging Het
Sync A T 4: 129,306,654 Q451L possibly damaging Het
Tbc1d31 A G 15: 57,967,933 Y929C probably benign Het
Thbs2 G A 17: 14,689,968 T123I probably damaging Het
Thsd7a A C 6: 12,331,927 probably null Het
Tnfrsf11a T C 1: 105,821,517 L220P probably damaging Het
Trbv13-2 G A 6: 41,121,818 C109Y probably damaging Het
Ugt3a1 G A 15: 9,306,360 W198* probably null Het
Usp14 G A 18: 9,996,189 R464W probably damaging Het
Vmn1r2 C T 4: 3,172,162 S27L probably benign Het
Vmn1r68 T A 7: 10,528,031 N47Y probably benign Het
Zfc3h1 T A 10: 115,427,039 Y1719* probably null Het
Other mutations in Gigyf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Gigyf1 APN 5 137522745 unclassified probably benign
IGL00326:Gigyf1 APN 5 137518948 utr 5 prime probably benign
IGL00935:Gigyf1 APN 5 137524834 missense possibly damaging 0.95
IGL01717:Gigyf1 APN 5 137525691 missense probably damaging 1.00
IGL02090:Gigyf1 APN 5 137525564 splice site probably null
IGL02354:Gigyf1 APN 5 137519727 splice site probably benign
IGL02361:Gigyf1 APN 5 137519727 splice site probably benign
IGL03370:Gigyf1 APN 5 137525690 missense possibly damaging 0.93
R1415:Gigyf1 UTSW 5 137519216 splice site probably null
R1764:Gigyf1 UTSW 5 137522508 unclassified probably benign
R2259:Gigyf1 UTSW 5 137520332 missense possibly damaging 0.93
R2260:Gigyf1 UTSW 5 137520332 missense possibly damaging 0.93
R4656:Gigyf1 UTSW 5 137525215 nonsense probably null
R4717:Gigyf1 UTSW 5 137525232 missense probably damaging 1.00
R4732:Gigyf1 UTSW 5 137524770 missense probably benign 0.39
R4733:Gigyf1 UTSW 5 137524770 missense probably benign 0.39
R4942:Gigyf1 UTSW 5 137525690 missense possibly damaging 0.93
R5338:Gigyf1 UTSW 5 137523160 unclassified probably benign
R5503:Gigyf1 UTSW 5 137523467 unclassified probably benign
R5790:Gigyf1 UTSW 5 137524255 unclassified probably benign
R5888:Gigyf1 UTSW 5 137525697 missense probably damaging 1.00
R5955:Gigyf1 UTSW 5 137523507 splice site probably null
R6544:Gigyf1 UTSW 5 137525059 missense probably damaging 1.00
R7227:Gigyf1 UTSW 5 137523823 missense unknown
R7493:Gigyf1 UTSW 5 137525533 missense probably damaging 0.98
R7660:Gigyf1 UTSW 5 137520969 missense probably benign 0.23
R7959:Gigyf1 UTSW 5 137524319 missense probably damaging 1.00
R8026:Gigyf1 UTSW 5 137525478 missense probably damaging 1.00
R8159:Gigyf1 UTSW 5 137522195 missense unknown
Predicted Primers PCR Primer
(F):5'- GCTCCAACTGCAGCATAAAG -3'
(R):5'- AGAGTCTTCATGGACAGGCC -3'

Sequencing Primer
(F):5'- TCCAACTGCAGCATAAAGTAAGTAG -3'
(R):5'- TTCATGGACAGGCCCTGCTTG -3'
Posted On2019-06-07