Incidental Mutation 'PIT4354001:Ccdc83'
ID554820
Institutional Source Beutler Lab
Gene Symbol Ccdc83
Ensembl Gene ENSMUSG00000030617
Gene Namecoiled-coil domain containing 83
Synonyms4930549K11Rik, 4930554C01Rik, 4932423M01Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4354001 (G1)
Quality Score153.008
Status Not validated
Chromosome7
Chromosomal Location90223873-90265777 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 90223974 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 391 (M391K)
Ref Sequence ENSEMBL: ENSMUSP00000102839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107221]
Predicted Effect probably benign
Transcript: ENSMUST00000107221
AA Change: M391K

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000102839
Gene: ENSMUSG00000030617
AA Change: M391K

DomainStartEndE-ValueType
coiled coil region 37 75 N/A INTRINSIC
low complexity region 93 106 N/A INTRINSIC
coiled coil region 107 182 N/A INTRINSIC
Blast:BROMO 202 232 1e-5 BLAST
low complexity region 241 249 N/A INTRINSIC
Coding Region Coverage
  • 1x: 92.5%
  • 3x: 90.1%
  • 10x: 83.2%
  • 20x: 69.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap2 A T 5: 62,654,049 Y1140N probably damaging Het
Cntnap1 A T 11: 101,181,297 I459F probably damaging Het
Cr2 T A 1: 195,166,309 Y302F probably damaging Het
Ctu2 A T 8: 122,478,975 D179V probably damaging Het
Cubn G A 2: 13,468,852 Q427* probably null Het
Depdc7 A G 2: 104,728,188 S163P probably benign Het
Eif2s3y C T Y: 1,020,126 R385C probably benign Het
Gigyf1 A G 5: 137,524,104 K728R unknown Het
Gm1587 G A 14: 77,797,033 R32* probably null Het
Gm17689 T A 9: 36,581,301 S103C possibly damaging Het
Hfe2 T C 3: 96,528,445 C340R probably damaging Het
Isy1 A G 6: 87,833,671 I53T possibly damaging Het
Myh8 A T 11: 67,289,630 N564I probably benign Het
Neb A T 2: 52,245,318 I3260N probably damaging Het
Npc1 C T 18: 12,211,535 G426E probably benign Het
Nrd1 G A 4: 109,054,025 probably null Het
Olfr1221 C A 2: 89,112,486 E9* probably null Het
Olfr1257 T A 2: 89,881,508 S227R probably benign Het
Olfr56 G A 11: 49,134,305 V38M probably damaging Het
Prss51 T A 14: 64,097,097 V91D probably damaging Het
Qpct A C 17: 79,081,759 Y280S probably benign Het
Rbpms A G 8: 33,806,838 V137A possibly damaging Het
Rgl2 T A 17: 33,933,940 M441K possibly damaging Het
Sdhaf3 A T 6: 6,956,072 I16F possibly damaging Het
Slc38a3 T G 9: 107,657,649 N176H probably benign Het
Sos1 T C 17: 80,449,356 S256G possibly damaging Het
Spg11 A T 2: 122,088,185 C988S probably damaging Het
Sync A T 4: 129,306,654 Q451L possibly damaging Het
Tbc1d31 A G 15: 57,967,933 Y929C probably benign Het
Thbs2 G A 17: 14,689,968 T123I probably damaging Het
Thsd7a A C 6: 12,331,927 probably null Het
Tnfrsf11a T C 1: 105,821,517 L220P probably damaging Het
Trbv13-2 G A 6: 41,121,818 C109Y probably damaging Het
Ugt3a1 G A 15: 9,306,360 W198* probably null Het
Usp14 G A 18: 9,996,189 R464W probably damaging Het
Vmn1r2 C T 4: 3,172,162 S27L probably benign Het
Vmn1r68 T A 7: 10,528,031 N47Y probably benign Het
Zfc3h1 T A 10: 115,427,039 Y1719* probably null Het
Other mutations in Ccdc83
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Ccdc83 APN 7 90244044 missense probably damaging 1.00
IGL01092:Ccdc83 APN 7 90247105 missense probably benign 0.11
IGL01394:Ccdc83 APN 7 90224001 missense probably damaging 1.00
IGL02585:Ccdc83 APN 7 90236912 missense probably damaging 1.00
IGL02631:Ccdc83 APN 7 90244069 missense possibly damaging 0.76
R0189:Ccdc83 UTSW 7 90226683 missense possibly damaging 0.94
R0538:Ccdc83 UTSW 7 90228383 missense probably damaging 0.99
R1441:Ccdc83 UTSW 7 90244143 missense probably damaging 1.00
R1478:Ccdc83 UTSW 7 90259469 missense probably damaging 0.99
R1781:Ccdc83 UTSW 7 90250541 missense probably damaging 1.00
R1929:Ccdc83 UTSW 7 90224077 missense probably damaging 1.00
R1969:Ccdc83 UTSW 7 90244154 missense probably damaging 1.00
R1970:Ccdc83 UTSW 7 90244154 missense probably damaging 1.00
R1971:Ccdc83 UTSW 7 90244154 missense probably damaging 1.00
R2008:Ccdc83 UTSW 7 90244141 missense probably damaging 1.00
R2220:Ccdc83 UTSW 7 90259514 missense probably damaging 0.96
R2271:Ccdc83 UTSW 7 90224077 missense probably damaging 1.00
R2426:Ccdc83 UTSW 7 90228431 missense probably damaging 1.00
R2985:Ccdc83 UTSW 7 90236367 intron probably benign
R3712:Ccdc83 UTSW 7 90236355 intron probably benign
R4241:Ccdc83 UTSW 7 90247138 missense probably damaging 1.00
R4260:Ccdc83 UTSW 7 90228391 missense possibly damaging 0.86
R4374:Ccdc83 UTSW 7 90226778 nonsense probably null
R5071:Ccdc83 UTSW 7 90250529 missense probably damaging 0.99
R5072:Ccdc83 UTSW 7 90250529 missense probably damaging 0.99
R5074:Ccdc83 UTSW 7 90250529 missense probably damaging 0.99
R5749:Ccdc83 UTSW 7 90223948 missense probably damaging 1.00
R5929:Ccdc83 UTSW 7 90236316 intron probably benign
R6283:Ccdc83 UTSW 7 90236407 nonsense probably null
R6574:Ccdc83 UTSW 7 90226677 missense possibly damaging 0.69
R6725:Ccdc83 UTSW 7 90247053 missense probably damaging 1.00
R7320:Ccdc83 UTSW 7 90224034 missense probably damaging 1.00
R7485:Ccdc83 UTSW 7 90223930 missense probably benign 0.17
R7511:Ccdc83 UTSW 7 90236922 missense possibly damaging 0.69
R7750:Ccdc83 UTSW 7 90223982 nonsense probably null
R7773:Ccdc83 UTSW 7 90229912 missense probably damaging 1.00
R7915:Ccdc83 UTSW 7 90244082 nonsense probably null
R8184:Ccdc83 UTSW 7 90224078 nonsense probably null
R8416:Ccdc83 UTSW 7 90236305 missense unknown
X0067:Ccdc83 UTSW 7 90247155 missense possibly damaging 0.94
Z1088:Ccdc83 UTSW 7 90244046 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTCTGTCACTCATGATGGGC -3'
(R):5'- GAGCATCTCATTTGTCACACAC -3'

Sequencing Primer
(F):5'- CACTCATGATGGGCAGGTATATC -3'
(R):5'- TTTGTCACACACACTTGCCAACG -3'
Posted On2019-06-07