Incidental Mutation 'PIT4354001:Rbpms'
ID554821
Institutional Source Beutler Lab
Gene Symbol Rbpms
Ensembl Gene ENSMUSG00000031586
Gene NameRNA binding protein gene with multiple splicing
Synonymshermes, 2700019M19Rik, 2010300K22Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.538) question?
Stock #PIT4354001 (G1)
Quality Score139.008
Status Not validated
Chromosome8
Chromosomal Location33782643-33929863 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33806838 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 137 (V137A)
Ref Sequence ENSEMBL: ENSMUSP00000033995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033994] [ENSMUST00000033995] [ENSMUST00000053251] [ENSMUST00000182256] [ENSMUST00000182987] [ENSMUST00000183062] [ENSMUST00000183088] [ENSMUST00000183336] [ENSMUST00000191473]
Predicted Effect probably benign
Transcript: ENSMUST00000033994
SMART Domains Protein: ENSMUSP00000033994
Gene: ENSMUSG00000031586

DomainStartEndE-ValueType
RRM 25 97 7.84e-8 SMART
low complexity region 149 172 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000033995
AA Change: V137A

PolyPhen 2 Score 0.610 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000033995
Gene: ENSMUSG00000031586
AA Change: V137A

DomainStartEndE-ValueType
RRM 25 97 7.84e-8 SMART
low complexity region 149 172 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000053251
AA Change: V137A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000055813
Gene: ENSMUSG00000031586
AA Change: V137A

DomainStartEndE-ValueType
RRM 25 97 7.84e-8 SMART
low complexity region 149 172 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182256
AA Change: V33A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138140
Gene: ENSMUSG00000031586
AA Change: V33A

DomainStartEndE-ValueType
low complexity region 45 68 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182926
Predicted Effect probably damaging
Transcript: ENSMUST00000182987
AA Change: V137A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138483
Gene: ENSMUSG00000031586
AA Change: V137A

DomainStartEndE-ValueType
RRM 25 97 7.84e-8 SMART
low complexity region 149 172 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183062
AA Change: V33A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138726
Gene: ENSMUSG00000031586
AA Change: V33A

DomainStartEndE-ValueType
low complexity region 45 63 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183088
AA Change: V135A

PolyPhen 2 Score 0.137 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000138420
Gene: ENSMUSG00000031586
AA Change: V135A

DomainStartEndE-ValueType
RRM 23 95 7.84e-8 SMART
low complexity region 147 159 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183336
SMART Domains Protein: ENSMUSP00000138533
Gene: ENSMUSG00000031586

DomainStartEndE-ValueType
low complexity region 12 35 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000191473
AA Change: V137A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140387
Gene: ENSMUSG00000031586
AA Change: V137A

DomainStartEndE-ValueType
RRM 25 97 7.84e-8 SMART
low complexity region 149 172 N/A INTRINSIC
Coding Region Coverage
  • 1x: 92.5%
  • 3x: 90.1%
  • 10x: 83.2%
  • 20x: 69.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RNA recognition motif family of RNA-binding proteins. The RNA recognition motif is between 80-100 amino acids in length and family members contain one to four copies of the motif. The RNA recognition motif consists of two short stretches of conserved sequence, as well as a few highly conserved hydrophobic residues. The encoded protein has a single, putative RNA recognition motif in its N-terminus. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap2 A T 5: 62,654,049 Y1140N probably damaging Het
Ccdc83 A T 7: 90,223,974 M391K probably benign Het
Cntnap1 A T 11: 101,181,297 I459F probably damaging Het
Cr2 T A 1: 195,166,309 Y302F probably damaging Het
Ctu2 A T 8: 122,478,975 D179V probably damaging Het
Cubn G A 2: 13,468,852 Q427* probably null Het
Depdc7 A G 2: 104,728,188 S163P probably benign Het
Eif2s3y C T Y: 1,020,126 R385C probably benign Het
Gigyf1 A G 5: 137,524,104 K728R unknown Het
Gm1587 G A 14: 77,797,033 R32* probably null Het
Gm17689 T A 9: 36,581,301 S103C possibly damaging Het
Hfe2 T C 3: 96,528,445 C340R probably damaging Het
Isy1 A G 6: 87,833,671 I53T possibly damaging Het
Myh8 A T 11: 67,289,630 N564I probably benign Het
Neb A T 2: 52,245,318 I3260N probably damaging Het
Npc1 C T 18: 12,211,535 G426E probably benign Het
Nrd1 G A 4: 109,054,025 probably null Het
Olfr1221 C A 2: 89,112,486 E9* probably null Het
Olfr1257 T A 2: 89,881,508 S227R probably benign Het
Olfr56 G A 11: 49,134,305 V38M probably damaging Het
Prss51 T A 14: 64,097,097 V91D probably damaging Het
Qpct A C 17: 79,081,759 Y280S probably benign Het
Rgl2 T A 17: 33,933,940 M441K possibly damaging Het
Sdhaf3 A T 6: 6,956,072 I16F possibly damaging Het
Slc38a3 T G 9: 107,657,649 N176H probably benign Het
Sos1 T C 17: 80,449,356 S256G possibly damaging Het
Spg11 A T 2: 122,088,185 C988S probably damaging Het
Sync A T 4: 129,306,654 Q451L possibly damaging Het
Tbc1d31 A G 15: 57,967,933 Y929C probably benign Het
Thbs2 G A 17: 14,689,968 T123I probably damaging Het
Thsd7a A C 6: 12,331,927 probably null Het
Tnfrsf11a T C 1: 105,821,517 L220P probably damaging Het
Trbv13-2 G A 6: 41,121,818 C109Y probably damaging Het
Ugt3a1 G A 15: 9,306,360 W198* probably null Het
Usp14 G A 18: 9,996,189 R464W probably damaging Het
Vmn1r2 C T 4: 3,172,162 S27L probably benign Het
Vmn1r68 T A 7: 10,528,031 N47Y probably benign Het
Zfc3h1 T A 10: 115,427,039 Y1719* probably null Het
Other mutations in Rbpms
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0637:Rbpms UTSW 8 33806836 missense probably damaging 1.00
R1183:Rbpms UTSW 8 33804072 missense possibly damaging 0.83
R2850:Rbpms UTSW 8 33834377 missense possibly damaging 0.94
R6722:Rbpms UTSW 8 33834393 missense probably damaging 1.00
R7576:Rbpms UTSW 8 33866388 missense probably damaging 1.00
R7689:Rbpms UTSW 8 33864359 missense possibly damaging 0.58
R7699:Rbpms UTSW 8 33864363 missense probably damaging 1.00
R7763:Rbpms UTSW 8 33789453 missense probably benign
R7909:Rbpms UTSW 8 33864359 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTCCTGGAGGTGGATCTG -3'
(R):5'- TTTGTGGGAAGCAAAGCATC -3'

Sequencing Primer
(F):5'- ACCGGGTCTGAAAGGGCTG -3'
(R):5'- TTTGTGGGAAGCAAAGCATCAGATTG -3'
Posted On2019-06-07