Incidental Mutation 'PIT4354001:Slc38a3'
ID554824
Institutional Source Beutler Lab
Gene Symbol Slc38a3
Ensembl Gene ENSMUSG00000010064
Gene Namesolute carrier family 38, member 3
SynonymsSnat3, 0610012J02Rik, D9Ucla2
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.692) question?
Stock #PIT4354001 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location107650634-107669530 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 107657649 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Histidine at position 176 (N176H)
Ref Sequence ENSEMBL: ENSMUSP00000010208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010208] [ENSMUST00000167868] [ENSMUST00000177567] [ENSMUST00000192323] [ENSMUST00000192990] [ENSMUST00000193932] [ENSMUST00000195843]
Predicted Effect probably benign
Transcript: ENSMUST00000010208
AA Change: N176H

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000010208
Gene: ENSMUSG00000010064
AA Change: N176H

DomainStartEndE-ValueType
Pfam:Aa_trans 63 492 1.8e-109 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167868
AA Change: N176H

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000130414
Gene: ENSMUSG00000010064
AA Change: N176H

DomainStartEndE-ValueType
Pfam:Aa_trans 63 492 1.8e-109 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177567
AA Change: N176H

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000137561
Gene: ENSMUSG00000010064
AA Change: N176H

DomainStartEndE-ValueType
Pfam:Aa_trans 63 492 5.5e-110 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192211
Predicted Effect probably benign
Transcript: ENSMUST00000192323
AA Change: N176H

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000141850
Gene: ENSMUSG00000010064
AA Change: N176H

DomainStartEndE-ValueType
Pfam:Aa_trans 63 181 2.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192990
SMART Domains Protein: ENSMUSP00000141528
Gene: ENSMUSG00000010064

DomainStartEndE-ValueType
Pfam:Aa_trans 63 154 1.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193932
AA Change: N176H

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000142087
Gene: ENSMUSG00000010064
AA Change: N176H

DomainStartEndE-ValueType
Pfam:Aa_trans 63 492 1.8e-109 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195739
Predicted Effect probably benign
Transcript: ENSMUST00000195843
SMART Domains Protein: ENSMUSP00000141552
Gene: ENSMUSG00000010064

DomainStartEndE-ValueType
Pfam:Aa_trans 63 99 6.4e-9 PFAM
Coding Region Coverage
  • 1x: 92.5%
  • 3x: 90.1%
  • 10x: 83.2%
  • 20x: 69.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU allele exhibit complete postnatal lethality between P18 and P20, altered amino acid levels in the serum, liver and brain, and decreased ammonia excretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap2 A T 5: 62,654,049 Y1140N probably damaging Het
Ccdc83 A T 7: 90,223,974 M391K probably benign Het
Cntnap1 A T 11: 101,181,297 I459F probably damaging Het
Cr2 T A 1: 195,166,309 Y302F probably damaging Het
Ctu2 A T 8: 122,478,975 D179V probably damaging Het
Cubn G A 2: 13,468,852 Q427* probably null Het
Depdc7 A G 2: 104,728,188 S163P probably benign Het
Eif2s3y C T Y: 1,020,126 R385C probably benign Het
Gigyf1 A G 5: 137,524,104 K728R unknown Het
Gm1587 G A 14: 77,797,033 R32* probably null Het
Gm17689 T A 9: 36,581,301 S103C possibly damaging Het
Hfe2 T C 3: 96,528,445 C340R probably damaging Het
Isy1 A G 6: 87,833,671 I53T possibly damaging Het
Myh8 A T 11: 67,289,630 N564I probably benign Het
Neb A T 2: 52,245,318 I3260N probably damaging Het
Npc1 C T 18: 12,211,535 G426E probably benign Het
Nrd1 G A 4: 109,054,025 probably null Het
Olfr1221 C A 2: 89,112,486 E9* probably null Het
Olfr1257 T A 2: 89,881,508 S227R probably benign Het
Olfr56 G A 11: 49,134,305 V38M probably damaging Het
Prss51 T A 14: 64,097,097 V91D probably damaging Het
Qpct A C 17: 79,081,759 Y280S probably benign Het
Rbpms A G 8: 33,806,838 V137A possibly damaging Het
Rgl2 T A 17: 33,933,940 M441K possibly damaging Het
Sdhaf3 A T 6: 6,956,072 I16F possibly damaging Het
Sos1 T C 17: 80,449,356 S256G possibly damaging Het
Spg11 A T 2: 122,088,185 C988S probably damaging Het
Sync A T 4: 129,306,654 Q451L possibly damaging Het
Tbc1d31 A G 15: 57,967,933 Y929C probably benign Het
Thbs2 G A 17: 14,689,968 T123I probably damaging Het
Thsd7a A C 6: 12,331,927 probably null Het
Tnfrsf11a T C 1: 105,821,517 L220P probably damaging Het
Trbv13-2 G A 6: 41,121,818 C109Y probably damaging Het
Ugt3a1 G A 15: 9,306,360 W198* probably null Het
Usp14 G A 18: 9,996,189 R464W probably damaging Het
Vmn1r2 C T 4: 3,172,162 S27L probably benign Het
Vmn1r68 T A 7: 10,528,031 N47Y probably benign Het
Zfc3h1 T A 10: 115,427,039 Y1719* probably null Het
Other mutations in Slc38a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Slc38a3 APN 9 107658677 missense probably damaging 1.00
R0522:Slc38a3 UTSW 9 107655213 splice site probably null
R0865:Slc38a3 UTSW 9 107655648 missense probably damaging 1.00
R0919:Slc38a3 UTSW 9 107655959 missense probably damaging 1.00
R1265:Slc38a3 UTSW 9 107651986 missense probably damaging 1.00
R1864:Slc38a3 UTSW 9 107655953 missense probably damaging 1.00
R2919:Slc38a3 UTSW 9 107657687 missense probably damaging 1.00
R4209:Slc38a3 UTSW 9 107655348 missense possibly damaging 0.78
R4343:Slc38a3 UTSW 9 107656472 missense possibly damaging 0.52
R4534:Slc38a3 UTSW 9 107656206 missense probably benign 0.00
R4535:Slc38a3 UTSW 9 107656206 missense probably benign 0.00
R4860:Slc38a3 UTSW 9 107655064 missense probably damaging 1.00
R4860:Slc38a3 UTSW 9 107655064 missense probably damaging 1.00
R4916:Slc38a3 UTSW 9 107656227 missense probably benign
R5058:Slc38a3 UTSW 9 107659191 missense possibly damaging 0.53
R5219:Slc38a3 UTSW 9 107651912 unclassified probably benign
R5776:Slc38a3 UTSW 9 107658749 nonsense probably null
R6029:Slc38a3 UTSW 9 107652175 missense probably damaging 1.00
R6146:Slc38a3 UTSW 9 107655029 missense probably benign
R6292:Slc38a3 UTSW 9 107655154 missense possibly damaging 0.88
R7250:Slc38a3 UTSW 9 107656666 missense probably benign 0.31
R8221:Slc38a3 UTSW 9 107657709 missense probably damaging 0.99
R8409:Slc38a3 UTSW 9 107659255 splice site probably benign
Predicted Primers PCR Primer
(F):5'- CCCATGATCAGGAATAGCAGG -3'
(R):5'- CATTGGAGGTGAGCAAGTGC -3'

Sequencing Primer
(F):5'- ACATGGGCCCTAGCTTTCG -3'
(R):5'- AGCAAGTGCCTGGGGTG -3'
Posted On2019-06-07