Mutagenetix > Incidental Mutations

Incidental Mutation 'PIT4354001:Slc38a3'

List |< first << previous [record 26 of 39] next >> last >|

554824

Institutional Source

Beutler Lab

Gene Symbol

Slc38a3

Ensembl Gene

ENSMUSG00000010064

Gene Name

solute carrier family 38, member 3

Synonyms

Snat3, 0610012J02Rik, D9Ucla2

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.713) question?

Stock #

PIT4354001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

107650634-107669530 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 107657649 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Histidine at position 176 (N176H)

Ref Sequence

ENSEMBL: ENSMUSP00000010208 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000010208] [ENSMUST00000167868] [ENSMUST00000177567] [ENSMUST00000192323] [ENSMUST00000192990] [ENSMUST00000193932] [ENSMUST00000195843]

Predicted Effect

probably benign
Transcript: ENSMUST00000010208
AA Change: N176H

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000010208
Gene: ENSMUSG00000010064
AA Change: N176H

Domain	Start	End	E-Value	Type
Pfam:Aa_trans	63	492	1.8e-109	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000167868
AA Change: N176H

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000130414
Gene: ENSMUSG00000010064
AA Change: N176H

Domain	Start	End	E-Value	Type
Pfam:Aa_trans	63	492	1.8e-109	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000177567
AA Change: N176H

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000137561
Gene: ENSMUSG00000010064
AA Change: N176H

Domain	Start	End	E-Value	Type
Pfam:Aa_trans	63	492	5.5e-110	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000192211

Predicted Effect

probably benign
Transcript: ENSMUST00000192323
AA Change: N176H

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000141850
Gene: ENSMUSG00000010064
AA Change: N176H

Domain	Start	End	E-Value	Type
Pfam:Aa_trans	63	181	2.5e-32	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000192990

SMART Domains

Protein: ENSMUSP00000141528
Gene: ENSMUSG00000010064

Domain	Start	End	E-Value	Type
Pfam:Aa_trans	63	154	1.7e-24	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000193932
AA Change: N176H

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000142087
Gene: ENSMUSG00000010064
AA Change: N176H

Domain	Start	End	E-Value	Type
Pfam:Aa_trans	63	492	1.8e-109	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000195739

Predicted Effect

probably benign
Transcript: ENSMUST00000195843

SMART Domains

Protein: ENSMUSP00000141552
Gene: ENSMUSG00000010064

Domain	Start	End	E-Value	Type
Pfam:Aa_trans	63	99	6.4e-9	PFAM

Coding Region Coverage

1x: 92.5%
3x: 90.1%
10x: 83.2%
20x: 69.0%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for an ENU allele exhibit complete postnatal lethality between P18 and P20, altered amino acid levels in the serum, liver and brain, and decreased ammonia excretion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arap2	A	T	5: 62,654,049	Y1140N	probably damaging	Het
Ccdc83	A	T	7: 90,223,974	M391K	probably benign	Het
Cntnap1	A	T	11: 101,181,297	I459F	probably damaging	Het
Cr2	T	A	1: 195,166,309	Y302F	probably damaging	Het
Ctu2	A	T	8: 122,478,975	D179V	probably damaging	Het
Cubn	G	A	2: 13,468,852	Q427*	probably null	Het
Depdc7	A	G	2: 104,728,188	S163P	probably benign	Het
Eif2s3y	C	T	Y: 1,020,126	R385C	probably benign	Het
Gigyf1	A	G	5: 137,524,104	K728R	unknown	Het
Gm1587	G	A	14: 77,797,033	R32*	probably null	Het
Gm17689	T	A	9: 36,581,301	S103C	possibly damaging	Het
Hfe2	T	C	3: 96,528,445	C340R	probably damaging	Het
Isy1	A	G	6: 87,833,671	I53T	possibly damaging	Het
Myh8	A	T	11: 67,289,630	N564I	probably benign	Het
Neb	A	T	2: 52,245,318	I3260N	probably damaging	Het
Npc1	C	T	18: 12,211,535	G426E	probably benign	Het
Nrd1	G	A	4: 109,054,025		probably null	Het
Olfr1221	C	A	2: 89,112,486	E9*	probably null	Het
Olfr1257	T	A	2: 89,881,508	S227R	probably benign	Het
Olfr56	G	A	11: 49,134,305	V38M	probably damaging	Het
Prss51	T	A	14: 64,097,097	V91D	probably damaging	Het
Qpct	A	C	17: 79,081,759	Y280S	probably benign	Het
Rbpms	A	G	8: 33,806,838	V137A	possibly damaging	Het
Rgl2	T	A	17: 33,933,940	M441K	possibly damaging	Het
Sdhaf3	A	T	6: 6,956,072	I16F	possibly damaging	Het
Sos1	T	C	17: 80,449,356	S256G	possibly damaging	Het
Spg11	A	T	2: 122,088,185	C988S	probably damaging	Het
Sync	A	T	4: 129,306,654	Q451L	possibly damaging	Het
Tbc1d31	A	G	15: 57,967,933	Y929C	probably benign	Het
Thbs2	G	A	17: 14,689,968	T123I	probably damaging	Het
Thsd7a	A	C	6: 12,331,927		probably null	Het
Tnfrsf11a	T	C	1: 105,821,517	L220P	probably damaging	Het
Trbv13-2	G	A	6: 41,121,818	C109Y	probably damaging	Het
Ugt3a1	G	A	15: 9,306,360	W198*	probably null	Het
Usp14	G	A	18: 9,996,189	R464W	probably damaging	Het
Vmn1r2	C	T	4: 3,172,162	S27L	probably benign	Het
Vmn1r68	T	A	7: 10,528,031	N47Y	probably benign	Het
Zfc3h1	T	A	10: 115,427,039	Y1719*	probably null	Het

Other mutations in Slc38a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00589:Slc38a3	APN	9	107658677	missense	probably damaging	1.00
R0522:Slc38a3	UTSW	9	107655213	splice site	probably null
R0865:Slc38a3	UTSW	9	107655648	missense	probably damaging	1.00
R0919:Slc38a3	UTSW	9	107655959	missense	probably damaging	1.00
R1265:Slc38a3	UTSW	9	107651986	missense	probably damaging	1.00
R1864:Slc38a3	UTSW	9	107655953	missense	probably damaging	1.00
R2919:Slc38a3	UTSW	9	107657687	missense	probably damaging	1.00
R4209:Slc38a3	UTSW	9	107655348	missense	possibly damaging	0.78
R4343:Slc38a3	UTSW	9	107656472	missense	possibly damaging	0.52
R4534:Slc38a3	UTSW	9	107656206	missense	probably benign	0.00
R4535:Slc38a3	UTSW	9	107656206	missense	probably benign	0.00
R4860:Slc38a3	UTSW	9	107655064	missense	probably damaging	1.00
R4860:Slc38a3	UTSW	9	107655064	missense	probably damaging	1.00
R4916:Slc38a3	UTSW	9	107656227	missense	probably benign
R5058:Slc38a3	UTSW	9	107659191	missense	possibly damaging	0.53
R5219:Slc38a3	UTSW	9	107651912	unclassified	probably benign
R5776:Slc38a3	UTSW	9	107658749	nonsense	probably null
R6029:Slc38a3	UTSW	9	107652175	missense	probably damaging	1.00
R6146:Slc38a3	UTSW	9	107655029	missense	probably benign
R6292:Slc38a3	UTSW	9	107655154	missense	possibly damaging	0.88
R7250:Slc38a3	UTSW	9	107656666	missense	probably benign	0.31
R8221:Slc38a3	UTSW	9	107657709	missense	probably damaging	0.99
R8409:Slc38a3	UTSW	9	107659255	splice site	probably benign

Predicted Primers

PCR Primer
(F):5'- CCCATGATCAGGAATAGCAGG -3'
(R):5'- CATTGGAGGTGAGCAAGTGC -3'

Sequencing Primer
(F):5'- ACATGGGCCCTAGCTTTCG -3'
(R):5'- AGCAAGTGCCTGGGGTG -3'

Posted On

2019-06-07