Incidental Mutation 'PIT4354001:Olfr56'
List |< first << previous [record 20 of 39] next >> last >|
ID554826
Institutional Source Beutler Lab
Gene Symbol Olfr56
Ensembl Gene ENSMUSG00000040328
Gene Nameolfactory receptor 56
SynonymsIF7, MOR276-1, GA_x6K02T2QP88-6300500-6299553
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #PIT4354001 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location48978889-49135387 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 49134305 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 38 (V38M)
Ref Sequence ENSEMBL: ENSMUSP00000145429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056759] [ENSMUST00000102785] [ENSMUST00000179282] [ENSMUST00000203149] [ENSMUST00000203810]
Predicted Effect probably damaging
Transcript: ENSMUST00000056759
AA Change: V6M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000058544
Gene: ENSMUSG00000040328
AA Change: V6M

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 4 227 5.7e-7 PFAM
Pfam:7tm_1 10 259 1.5e-33 PFAM
Pfam:7tm_4 108 252 1.7e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102785
AA Change: V6M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099846
Gene: ENSMUSG00000040328
AA Change: V6M

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 4 227 5.7e-7 PFAM
Pfam:7tm_1 10 259 1.5e-33 PFAM
Pfam:7tm_4 108 252 1.7e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000179282
AA Change: V6M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000136647
Gene: ENSMUSG00000040328
AA Change: V6M

DomainStartEndE-ValueType
Pfam:7tm_4 1 276 3.6e-51 PFAM
Pfam:7TM_GPCR_Srsx 4 227 5.7e-7 PFAM
Pfam:7tm_1 10 259 3.8e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203149
AA Change: V38M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000145429
Gene: ENSMUSG00000040328
AA Change: V38M

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 2.6e-51 PFAM
Pfam:7TM_GPCR_Srsx 36 253 3.8e-7 PFAM
Pfam:7tm_1 42 291 2.5e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203810
AA Change: V38M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000144951
Gene: ENSMUSG00000040328
AA Change: V38M

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 2.6e-51 PFAM
Pfam:7TM_GPCR_Srsx 36 253 3.8e-7 PFAM
Pfam:7tm_1 42 291 2.5e-26 PFAM
Coding Region Coverage
  • 1x: 92.5%
  • 3x: 90.1%
  • 10x: 83.2%
  • 20x: 69.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap2 A T 5: 62,654,049 Y1140N probably damaging Het
Ccdc83 A T 7: 90,223,974 M391K probably benign Het
Cntnap1 A T 11: 101,181,297 I459F probably damaging Het
Cr2 T A 1: 195,166,309 Y302F probably damaging Het
Ctu2 A T 8: 122,478,975 D179V probably damaging Het
Cubn G A 2: 13,468,852 Q427* probably null Het
Depdc7 A G 2: 104,728,188 S163P probably benign Het
Eif2s3y C T Y: 1,020,126 R385C probably benign Het
Gigyf1 A G 5: 137,524,104 K728R unknown Het
Gm1587 G A 14: 77,797,033 R32* probably null Het
Gm17689 T A 9: 36,581,301 S103C possibly damaging Het
Hfe2 T C 3: 96,528,445 C340R probably damaging Het
Isy1 A G 6: 87,833,671 I53T possibly damaging Het
Myh8 A T 11: 67,289,630 N564I probably benign Het
Neb A T 2: 52,245,318 I3260N probably damaging Het
Npc1 C T 18: 12,211,535 G426E probably benign Het
Nrd1 G A 4: 109,054,025 probably null Het
Olfr1221 C A 2: 89,112,486 E9* probably null Het
Olfr1257 T A 2: 89,881,508 S227R probably benign Het
Prss51 T A 14: 64,097,097 V91D probably damaging Het
Qpct A C 17: 79,081,759 Y280S probably benign Het
Rbpms A G 8: 33,806,838 V137A possibly damaging Het
Rgl2 T A 17: 33,933,940 M441K possibly damaging Het
Sdhaf3 A T 6: 6,956,072 I16F possibly damaging Het
Slc38a3 T G 9: 107,657,649 N176H probably benign Het
Sos1 T C 17: 80,449,356 S256G possibly damaging Het
Spg11 A T 2: 122,088,185 C988S probably damaging Het
Sync A T 4: 129,306,654 Q451L possibly damaging Het
Tbc1d31 A G 15: 57,967,933 Y929C probably benign Het
Thbs2 G A 17: 14,689,968 T123I probably damaging Het
Thsd7a A C 6: 12,331,927 probably null Het
Tnfrsf11a T C 1: 105,821,517 L220P probably damaging Het
Trbv13-2 G A 6: 41,121,818 C109Y probably damaging Het
Ugt3a1 G A 15: 9,306,360 W198* probably null Het
Usp14 G A 18: 9,996,189 R464W probably damaging Het
Vmn1r2 C T 4: 3,172,162 S27L probably benign Het
Vmn1r68 T A 7: 10,528,031 N47Y probably benign Het
Zfc3h1 T A 10: 115,427,039 Y1719* probably null Het
Other mutations in Olfr56
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0200:Olfr56 UTSW 11 49135047 missense probably damaging 0.99
R0540:Olfr56 UTSW 11 49134722 missense probably damaging 1.00
R0607:Olfr56 UTSW 11 49134722 missense probably damaging 1.00
R4877:Olfr56 UTSW 11 49134781 missense probably damaging 1.00
R5027:Olfr56 UTSW 11 49134624 missense probably benign 0.35
R5598:Olfr56 UTSW 11 49135114 missense probably benign 0.00
R5952:Olfr56 UTSW 11 49134572 missense probably damaging 1.00
R6191:Olfr56 UTSW 11 49135050 missense probably damaging 1.00
R6475:Olfr56 UTSW 11 49134933 missense probably benign 0.01
R6565:Olfr56 UTSW 11 49134812 missense probably damaging 0.99
R6807:Olfr56 UTSW 11 49134978 missense probably damaging 1.00
R7228:Olfr56 UTSW 11 49134879 missense possibly damaging 0.52
R7792:Olfr56 UTSW 11 49134669 missense possibly damaging 0.95
R8255:Olfr56 UTSW 11 49134480 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGCATGGTGCTTCATCTCAG -3'
(R):5'- AGTCCTAACAAGAGACCCTCTG -3'

Sequencing Primer
(F):5'- ATGGTGCTTCATCTCAGAACGTC -3'
(R):5'- ATTTGTATGCCACAGCCGG -3'
Posted On2019-06-07