Mutagenetix > Incidental Mutations

Incidental Mutation 'PIT4354001:Olfr56'

List |< first << previous [record 20 of 39] next >> last >|

554826

Institutional Source

Beutler Lab

Gene Symbol

Olfr56

Ensembl Gene

ENSMUSG00000040328

Gene Name

olfactory receptor 56

Synonyms

IF7, MOR276-1, GA_x6K02T2QP88-6300500-6299553

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.091) question?

Stock #

PIT4354001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

48978889-49135387 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 49134305 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 38 (V38M)

Ref Sequence

ENSEMBL: ENSMUSP00000145429 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056759] [ENSMUST00000102785] [ENSMUST00000179282] [ENSMUST00000203149] [ENSMUST00000203810]

Predicted Effect

probably damaging
Transcript: ENSMUST00000056759
AA Change: V6M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000058544
Gene: ENSMUSG00000040328
AA Change: V6M

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srsx	4	227	5.7e-7	PFAM
Pfam:7tm_1	10	259	1.5e-33	PFAM
Pfam:7tm_4	108	252	1.7e-46	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000102785
AA Change: V6M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000099846
Gene: ENSMUSG00000040328
AA Change: V6M

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srsx	4	227	5.7e-7	PFAM
Pfam:7tm_1	10	259	1.5e-33	PFAM
Pfam:7tm_4	108	252	1.7e-46	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000179282
AA Change: V6M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000136647
Gene: ENSMUSG00000040328
AA Change: V6M

Domain	Start	End	E-Value	Type
Pfam:7tm_4	1	276	3.6e-51	PFAM
Pfam:7TM_GPCR_Srsx	4	227	5.7e-7	PFAM
Pfam:7tm_1	10	259	3.8e-26	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000203149
AA Change: V38M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000145429
Gene: ENSMUSG00000040328
AA Change: V38M

Domain	Start	End	E-Value	Type
Pfam:7tm_4	32	308	2.6e-51	PFAM
Pfam:7TM_GPCR_Srsx	36	253	3.8e-7	PFAM
Pfam:7tm_1	42	291	2.5e-26	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000203810
AA Change: V38M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000144951
Gene: ENSMUSG00000040328
AA Change: V38M

Domain	Start	End	E-Value	Type
Pfam:7tm_4	32	308	2.6e-51	PFAM
Pfam:7TM_GPCR_Srsx	36	253	3.8e-7	PFAM
Pfam:7tm_1	42	291	2.5e-26	PFAM

Coding Region Coverage

1x: 92.5%
3x: 90.1%
10x: 83.2%
20x: 69.0%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arap2	A	T	5: 62,654,049	Y1140N	probably damaging	Het
Ccdc83	A	T	7: 90,223,974	M391K	probably benign	Het
Cntnap1	A	T	11: 101,181,297	I459F	probably damaging	Het
Cr2	T	A	1: 195,166,309	Y302F	probably damaging	Het
Ctu2	A	T	8: 122,478,975	D179V	probably damaging	Het
Cubn	G	A	2: 13,468,852	Q427*	probably null	Het
Depdc7	A	G	2: 104,728,188	S163P	probably benign	Het
Eif2s3y	C	T	Y: 1,020,126	R385C	probably benign	Het
Gigyf1	A	G	5: 137,524,104	K728R	unknown	Het
Gm1587	G	A	14: 77,797,033	R32*	probably null	Het
Gm17689	T	A	9: 36,581,301	S103C	possibly damaging	Het
Hfe2	T	C	3: 96,528,445	C340R	probably damaging	Het
Isy1	A	G	6: 87,833,671	I53T	possibly damaging	Het
Myh8	A	T	11: 67,289,630	N564I	probably benign	Het
Neb	A	T	2: 52,245,318	I3260N	probably damaging	Het
Npc1	C	T	18: 12,211,535	G426E	probably benign	Het
Nrd1	G	A	4: 109,054,025		probably null	Het
Olfr1221	C	A	2: 89,112,486	E9*	probably null	Het
Olfr1257	T	A	2: 89,881,508	S227R	probably benign	Het
Prss51	T	A	14: 64,097,097	V91D	probably damaging	Het
Qpct	A	C	17: 79,081,759	Y280S	probably benign	Het
Rbpms	A	G	8: 33,806,838	V137A	possibly damaging	Het
Rgl2	T	A	17: 33,933,940	M441K	possibly damaging	Het
Sdhaf3	A	T	6: 6,956,072	I16F	possibly damaging	Het
Slc38a3	T	G	9: 107,657,649	N176H	probably benign	Het
Sos1	T	C	17: 80,449,356	S256G	possibly damaging	Het
Spg11	A	T	2: 122,088,185	C988S	probably damaging	Het
Sync	A	T	4: 129,306,654	Q451L	possibly damaging	Het
Tbc1d31	A	G	15: 57,967,933	Y929C	probably benign	Het
Thbs2	G	A	17: 14,689,968	T123I	probably damaging	Het
Thsd7a	A	C	6: 12,331,927		probably null	Het
Tnfrsf11a	T	C	1: 105,821,517	L220P	probably damaging	Het
Trbv13-2	G	A	6: 41,121,818	C109Y	probably damaging	Het
Ugt3a1	G	A	15: 9,306,360	W198*	probably null	Het
Usp14	G	A	18: 9,996,189	R464W	probably damaging	Het
Vmn1r2	C	T	4: 3,172,162	S27L	probably benign	Het
Vmn1r68	T	A	7: 10,528,031	N47Y	probably benign	Het
Zfc3h1	T	A	10: 115,427,039	Y1719*	probably null	Het

Other mutations in Olfr56

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0200:Olfr56	UTSW	11	49135047	missense	probably damaging	0.99
R0540:Olfr56	UTSW	11	49134722	missense	probably damaging	1.00
R0607:Olfr56	UTSW	11	49134722	missense	probably damaging	1.00
R4877:Olfr56	UTSW	11	49134781	missense	probably damaging	1.00
R5027:Olfr56	UTSW	11	49134624	missense	probably benign	0.35
R5598:Olfr56	UTSW	11	49135114	missense	probably benign	0.00
R5952:Olfr56	UTSW	11	49134572	missense	probably damaging	1.00
R6191:Olfr56	UTSW	11	49135050	missense	probably damaging	1.00
R6475:Olfr56	UTSW	11	49134933	missense	probably benign	0.01
R6565:Olfr56	UTSW	11	49134812	missense	probably damaging	0.99
R6807:Olfr56	UTSW	11	49134978	missense	probably damaging	1.00
R7228:Olfr56	UTSW	11	49134879	missense	possibly damaging	0.52
R7792:Olfr56	UTSW	11	49134669	missense	possibly damaging	0.95
R8255:Olfr56	UTSW	11	49134480	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- GGCATGGTGCTTCATCTCAG -3'
(R):5'- AGTCCTAACAAGAGACCCTCTG -3'

Sequencing Primer
(F):5'- ATGGTGCTTCATCTCAGAACGTC -3'
(R):5'- ATTTGTATGCCACAGCCGG -3'

Posted On

2019-06-07