Mutagenetix > Incidental Mutations

Incidental Mutation 'PIT4354001:Cntnap1'

List |< first << previous [record 3 of 39] next >> last >|

554828

Institutional Source

Beutler Lab

Gene Symbol

Cntnap1

Ensembl Gene

ENSMUSG00000017167

Gene Name

contactin associated protein-like 1

Synonyms

Nrxn4, Caspr, NCP1, p190, paranodin, shm

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.548) question?

Stock #

PIT4354001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

101170523-101190724 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 101181297 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 459 (I459F)

Ref Sequence

ENSEMBL: ENSMUSP00000099398 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103109]

Predicted Effect

probably damaging
Transcript: ENSMUST00000103109
AA Change: I459F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000099398
Gene: ENSMUSG00000017167
AA Change: I459F

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
FA58C	25	169	7.49e-36	SMART
LamG	196	333	2.86e-32	SMART
LamG	382	516	3.49e-27	SMART
EGF	544	578	2.28e0	SMART
Blast:FBG	580	777	1e-133	BLAST
LamG	806	940	1.95e-25	SMART
EGF_like	961	997	6.03e1	SMART
low complexity region	1032	1044	N/A	INTRINSIC
low complexity region	1047	1058	N/A	INTRINSIC
low complexity region	1063	1078	N/A	INTRINSIC
LamG	1081	1219	2.59e-30	SMART
4.1m	1305	1323	7.85e-7	SMART
low complexity region	1333	1370	N/A	INTRINSIC

Coding Region Coverage

1x: 92.5%
3x: 90.1%
10x: 83.2%
20x: 69.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene product was initially identified as a 190-kD protein associated with the contactin-PTPRZ1 complex. The 1,384-amino acid protein, also designated p190 or CASPR for 'contactin-associated protein,' includes an extracellular domain with several putative protein-protein interaction domains, a putative transmembrane domain, and a 74-amino acid cytoplasmic domain. Northern blot analysis showed that the gene is transcribed predominantly in brain as a transcript of 6.2 kb, with weak expression in several other tissues tested. The architecture of its extracellular domain is similar to that of neurexins, and this protein may be the signaling subunit of contactin, enabling recruitment and activation of intracellular signaling pathways in neurons. [provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygous mutant mice exhibit reduced body size and nervous system defects, including impaired balance, hypoactivity, and ataxia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arap2	A	T	5: 62,654,049	Y1140N	probably damaging	Het
Ccdc83	A	T	7: 90,223,974	M391K	probably benign	Het
Cr2	T	A	1: 195,166,309	Y302F	probably damaging	Het
Ctu2	A	T	8: 122,478,975	D179V	probably damaging	Het
Cubn	G	A	2: 13,468,852	Q427*	probably null	Het
Depdc7	A	G	2: 104,728,188	S163P	probably benign	Het
Eif2s3y	C	T	Y: 1,020,126	R385C	probably benign	Het
Gigyf1	A	G	5: 137,524,104	K728R	unknown	Het
Gm1587	G	A	14: 77,797,033	R32*	probably null	Het
Gm17689	T	A	9: 36,581,301	S103C	possibly damaging	Het
Hfe2	T	C	3: 96,528,445	C340R	probably damaging	Het
Isy1	A	G	6: 87,833,671	I53T	possibly damaging	Het
Myh8	A	T	11: 67,289,630	N564I	probably benign	Het
Neb	A	T	2: 52,245,318	I3260N	probably damaging	Het
Npc1	C	T	18: 12,211,535	G426E	probably benign	Het
Nrd1	G	A	4: 109,054,025		probably null	Het
Olfr1221	C	A	2: 89,112,486	E9*	probably null	Het
Olfr1257	T	A	2: 89,881,508	S227R	probably benign	Het
Olfr56	G	A	11: 49,134,305	V38M	probably damaging	Het
Prss51	T	A	14: 64,097,097	V91D	probably damaging	Het
Qpct	A	C	17: 79,081,759	Y280S	probably benign	Het
Rbpms	A	G	8: 33,806,838	V137A	possibly damaging	Het
Rgl2	T	A	17: 33,933,940	M441K	possibly damaging	Het
Sdhaf3	A	T	6: 6,956,072	I16F	possibly damaging	Het
Slc38a3	T	G	9: 107,657,649	N176H	probably benign	Het
Sos1	T	C	17: 80,449,356	S256G	possibly damaging	Het
Spg11	A	T	2: 122,088,185	C988S	probably damaging	Het
Sync	A	T	4: 129,306,654	Q451L	possibly damaging	Het
Tbc1d31	A	G	15: 57,967,933	Y929C	probably benign	Het
Thbs2	G	A	17: 14,689,968	T123I	probably damaging	Het
Thsd7a	A	C	6: 12,331,927		probably null	Het
Tnfrsf11a	T	C	1: 105,821,517	L220P	probably damaging	Het
Trbv13-2	G	A	6: 41,121,818	C109Y	probably damaging	Het
Ugt3a1	G	A	15: 9,306,360	W198*	probably null	Het
Usp14	G	A	18: 9,996,189	R464W	probably damaging	Het
Vmn1r2	C	T	4: 3,172,162	S27L	probably benign	Het
Vmn1r68	T	A	7: 10,528,031	N47Y	probably benign	Het
Zfc3h1	T	A	10: 115,427,039	Y1719*	probably null	Het

Other mutations in Cntnap1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00684:Cntnap1	APN	11	101185092	missense	possibly damaging	0.63
IGL00715:Cntnap1	APN	11	101183205	splice site	probably benign
IGL00792:Cntnap1	APN	11	101178966	missense	probably benign	0.19
IGL01063:Cntnap1	APN	11	101181788	missense	probably benign	0.00
IGL01141:Cntnap1	APN	11	101178807	splice site	probably benign
IGL02184:Cntnap1	APN	11	101178365	missense	probably damaging	0.98
IGL02272:Cntnap1	APN	11	101178316	missense	probably damaging	0.99
IGL02281:Cntnap1	APN	11	101182254	missense	possibly damaging	0.86
IGL02437:Cntnap1	APN	11	101186851	missense	probably damaging	1.00
IGL02456:Cntnap1	APN	11	101178129	missense	probably benign	0.31
IGL02966:Cntnap1	APN	11	101184749	missense	probably damaging	1.00
IGL03126:Cntnap1	APN	11	101176301	missense	probably benign	0.00
IGL03294:Cntnap1	APN	11	101181682	missense	possibly damaging	0.94
Penny	UTSW	11	101186764	missense	probably damaging	0.99
FR4304:Cntnap1	UTSW	11	101189581	unclassified	probably benign
FR4304:Cntnap1	UTSW	11	101189589	unclassified	probably benign
FR4342:Cntnap1	UTSW	11	101189575	unclassified	probably benign
FR4449:Cntnap1	UTSW	11	101189569	unclassified	probably benign
FR4449:Cntnap1	UTSW	11	101189593	unclassified	probably benign
FR4548:Cntnap1	UTSW	11	101189572	unclassified	probably benign
FR4548:Cntnap1	UTSW	11	101189579	unclassified	probably benign
FR4548:Cntnap1	UTSW	11	101189593	unclassified	probably benign
FR4548:Cntnap1	UTSW	11	101189594	unclassified	probably benign
FR4589:Cntnap1	UTSW	11	101189566	unclassified	probably benign
FR4589:Cntnap1	UTSW	11	101189575	unclassified	probably benign
FR4589:Cntnap1	UTSW	11	101189580	unclassified	probably benign
FR4589:Cntnap1	UTSW	11	101189581	unclassified	probably benign
FR4737:Cntnap1	UTSW	11	101189569	unclassified	probably benign
FR4737:Cntnap1	UTSW	11	101189576	unclassified	probably benign
FR4737:Cntnap1	UTSW	11	101189582	unclassified	probably benign
FR4737:Cntnap1	UTSW	11	101189590	unclassified	probably benign
FR4976:Cntnap1	UTSW	11	101189569	unclassified	probably benign
FR4976:Cntnap1	UTSW	11	101189572	unclassified	probably benign
FR4976:Cntnap1	UTSW	11	101189585	unclassified	probably benign
FR4976:Cntnap1	UTSW	11	101189588	unclassified	probably benign
PIT4466001:Cntnap1	UTSW	11	101177305	missense	probably benign
R0329:Cntnap1	UTSW	11	101188309	missense	probably damaging	1.00
R0556:Cntnap1	UTSW	11	101183996	missense	probably benign
R0586:Cntnap1	UTSW	11	101187014	missense	probably damaging	0.97
R0635:Cntnap1	UTSW	11	101183459	missense	probably benign	0.05
R0789:Cntnap1	UTSW	11	101181384	splice site	probably benign
R1016:Cntnap1	UTSW	11	101177507	missense	probably damaging	0.99
R1085:Cntnap1	UTSW	11	101178836	missense	probably benign	0.02
R1211:Cntnap1	UTSW	11	101184710	missense	probably damaging	1.00
R1466:Cntnap1	UTSW	11	101180360	missense	probably damaging	1.00
R1466:Cntnap1	UTSW	11	101180360	missense	probably damaging	1.00
R1584:Cntnap1	UTSW	11	101180360	missense	probably damaging	1.00
R1689:Cntnap1	UTSW	11	101188873	splice site	probably null
R1758:Cntnap1	UTSW	11	101184623	missense	probably damaging	1.00
R1779:Cntnap1	UTSW	11	101186511	missense	probably damaging	0.99
R1964:Cntnap1	UTSW	11	101178024	nonsense	probably null
R1966:Cntnap1	UTSW	11	101180386	missense	possibly damaging	0.89
R2070:Cntnap1	UTSW	11	101182979	missense	probably damaging	1.00
R2088:Cntnap1	UTSW	11	101182547	missense	probably damaging	1.00
R2118:Cntnap1	UTSW	11	101188657	missense	probably benign
R3795:Cntnap1	UTSW	11	101186764	missense	probably damaging	0.99
R4375:Cntnap1	UTSW	11	101182253	missense	probably damaging	1.00
R4779:Cntnap1	UTSW	11	101178072	missense	possibly damaging	0.91
R4832:Cntnap1	UTSW	11	101183019	missense	probably damaging	1.00
R4965:Cntnap1	UTSW	11	101177425	missense	possibly damaging	0.52
R4981:Cntnap1	UTSW	11	101176333	splice site	probably null
R5008:Cntnap1	UTSW	11	101188741	nonsense	probably null
R5399:Cntnap1	UTSW	11	101183316	missense	probably benign
R5507:Cntnap1	UTSW	11	101183477	missense	probably benign	0.42
R5560:Cntnap1	UTSW	11	101182435	missense	probably damaging	1.00
R5589:Cntnap1	UTSW	11	101185118	missense	probably benign
R6038:Cntnap1	UTSW	11	101184636	missense	probably benign	0.12
R6038:Cntnap1	UTSW	11	101184636	missense	probably benign	0.12
R6242:Cntnap1	UTSW	11	101182538	missense	probably damaging	1.00
R6306:Cntnap1	UTSW	11	101184615	missense	probably damaging	1.00
R6392:Cntnap1	UTSW	11	101186646	missense	probably damaging	1.00
R6803:Cntnap1	UTSW	11	101177234	missense	possibly damaging	0.81
R6939:Cntnap1	UTSW	11	101186511	missense	probably damaging	0.99
R6944:Cntnap1	UTSW	11	101182904	missense	probably damaging	0.97
R7152:Cntnap1	UTSW	11	101177326	missense	probably damaging	1.00
R7297:Cntnap1	UTSW	11	101188634	missense	probably benign	0.01
R7347:Cntnap1	UTSW	11	101185268	missense	probably damaging	1.00
R7961:Cntnap1	UTSW	11	101178295	missense	probably benign
R7980:Cntnap1	UTSW	11	101188893	missense	probably benign
R8307:Cntnap1	UTSW	11	101188876	missense	possibly damaging	0.73
R8386:Cntnap1	UTSW	11	101182203	missense	probably damaging	1.00
R8403:Cntnap1	UTSW	11	101177590	missense	probably damaging	1.00
RF042:Cntnap1	UTSW	11	101180305	critical splice acceptor site	probably benign
RF048:Cntnap1	UTSW	11	101180305	critical splice acceptor site	probably benign
RF048:Cntnap1	UTSW	11	101189563	unclassified	probably benign
RF049:Cntnap1	UTSW	11	101189592	unclassified	probably benign
RF049:Cntnap1	UTSW	11	101189596	unclassified	probably benign
RF050:Cntnap1	UTSW	11	101189592	unclassified	probably benign
Z1176:Cntnap1	UTSW	11	101182898	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAGCTACTAAACTGCTCTCCACG -3'
(R):5'- GTGAAAGGAGGATTGGTCTCTCC -3'

Sequencing Primer
(F):5'- TGATTCCATGAGGATCCAGC -3'
(R):5'- CAATACTCTCTATGTGGCCCCATCAG -3'

Posted On

2019-06-07