Incidental Mutation 'R0602:Vmn1r171'
ID55483
Institutional Source Beutler Lab
Gene Symbol Vmn1r171
Ensembl Gene ENSMUSG00000062483
Gene Namevomeronasal 1 receptor 171
SynonymsV3R7, V1rd7
MMRRC Submission 038791-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R0602 (G1)
Quality Score201
Status Validated
Chromosome7
Chromosomal Location23630722-23634370 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 23633177 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 276 (V276L)
Ref Sequence ENSEMBL: ENSMUSP00000077552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078458] [ENSMUST00000226128] [ENSMUST00000226321] [ENSMUST00000226733] [ENSMUST00000226771] [ENSMUST00000227386] [ENSMUST00000227774] [ENSMUST00000227866] [ENSMUST00000228228] [ENSMUST00000228484] [ENSMUST00000228559] [ENSMUST00000228674] [ENSMUST00000228681]
Predicted Effect probably benign
Transcript: ENSMUST00000078458
AA Change: V276L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000077552
Gene: ENSMUSG00000062483
AA Change: V276L

DomainStartEndE-ValueType
Pfam:TAS2R 20 307 1.7e-14 PFAM
Pfam:7tm_1 42 300 3.4e-7 PFAM
Pfam:V1R 53 307 1.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226128
AA Change: V264L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000226321
AA Change: V264L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000226733
AA Change: V264L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000226771
AA Change: V264L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000227386
AA Change: V264L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000227774
AA Change: V264L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000227866
AA Change: V264L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000228228
AA Change: V264L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000228484
AA Change: V264L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000228559
AA Change: V264L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000228674
AA Change: V264L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000228681
AA Change: V264L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 99.1%
  • 10x: 97.5%
  • 20x: 94.7%
Validation Efficiency 95% (58/61)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430038I01Rik T C 7: 137,376,361 probably benign Het
A530032D15Rik C G 1: 85,099,505 K113N probably benign Het
Arih1 A G 9: 59,394,871 probably benign Het
Bcl9 T C 3: 97,205,786 I1118V probably benign Het
Cap1 T C 4: 122,872,409 E12G probably damaging Het
Ccr2 A G 9: 124,106,621 I313V probably benign Het
Cd1d2 T C 3: 86,987,803 S161P probably benign Het
Cd226 C T 18: 89,269,011 T311I probably benign Het
Col25a1 A G 3: 130,575,414 probably null Het
Cspg4 T C 9: 56,888,017 F1012S probably damaging Het
Dnah7b A G 1: 46,324,842 M3541V probably damaging Het
Erbb2 G A 11: 98,434,271 V852M probably damaging Het
Fer1l6 A C 15: 58,577,945 T667P probably damaging Het
Gal3st2c A G 1: 94,009,179 Y282C probably damaging Het
Glp1r T C 17: 30,909,227 L60P probably benign Het
Gm8251 T A 1: 44,059,967 K657I possibly damaging Het
Gtf2h2 A G 13: 100,469,025 V358A probably benign Het
Hephl1 T A 9: 15,089,051 I302F probably damaging Het
Hist2h2aa1 T C 3: 96,245,550 probably benign Het
Lgi2 T C 5: 52,554,423 D185G probably damaging Het
Lrtm1 T C 14: 29,022,222 probably benign Het
Megf10 T G 18: 57,262,100 D511E probably damaging Het
Myo5c A G 9: 75,266,196 probably null Het
Nrbf2 G A 10: 67,267,826 T166M probably damaging Het
Nrm C A 17: 35,864,264 Y61* probably null Het
Ola1 A G 2: 73,093,712 Y368H probably damaging Het
Olfr1497 T C 19: 13,794,662 probably null Het
Olfr1505 A G 19: 13,919,781 T254A probably benign Het
Olfr593 A C 7: 103,212,580 H229P possibly damaging Het
Panx1 A G 9: 15,010,204 L125P probably damaging Het
Pappa2 A G 1: 158,763,055 probably benign Het
Parp6 A G 9: 59,649,365 probably benign Het
Pomgnt2 A G 9: 121,982,273 Y481H probably benign Het
Ppp4c A G 7: 126,789,082 probably benign Het
Prl8a8 T A 13: 27,508,550 probably benign Het
Prpf40b C A 15: 99,304,471 A70E unknown Het
Ptgfr G A 3: 151,835,202 T223M probably damaging Het
Ptprc C T 1: 138,089,485 probably benign Het
Rgs22 T C 15: 36,139,872 probably benign Het
Rpgrip1 A G 14: 52,133,856 E344G possibly damaging Het
Sgca A T 11: 94,963,235 I383N possibly damaging Het
Sgms2 T A 3: 131,325,107 probably null Het
Slc9b1 C A 3: 135,397,755 Q549K probably benign Het
Smc4 G C 3: 69,009,538 A187P probably damaging Het
Smco1 A G 16: 32,273,244 S47G probably damaging Het
Sobp T A 10: 43,022,389 E400V probably damaging Het
Stil T A 4: 115,024,423 probably benign Het
Sult3a2 A T 10: 33,782,048 M23K probably benign Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tcof1 C A 18: 60,833,533 G329W probably damaging Het
Ttc13 A T 8: 124,674,366 S624T probably damaging Het
Vps13b T C 15: 35,422,368 L158P probably damaging Het
Vps54 A G 11: 21,306,434 I634M possibly damaging Het
Vwa8 T G 14: 79,020,620 S736R probably benign Het
Other mutations in Vmn1r171
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Vmn1r171 APN 7 23632827 missense probably damaging 1.00
IGL02963:Vmn1r171 APN 7 23632688 missense possibly damaging 0.62
FR4304:Vmn1r171 UTSW 7 23632680 missense probably benign 0.26
R0412:Vmn1r171 UTSW 7 23632655 missense possibly damaging 0.81
R0710:Vmn1r171 UTSW 7 23633001 missense probably damaging 1.00
R1758:Vmn1r171 UTSW 7 23632356 missense probably benign 0.25
R2007:Vmn1r171 UTSW 7 23632587 missense probably damaging 1.00
R4153:Vmn1r171 UTSW 7 23632652 missense probably damaging 1.00
R4799:Vmn1r171 UTSW 7 23632944 missense probably benign 0.31
R5038:Vmn1r171 UTSW 7 23632763 missense probably benign 0.00
R6087:Vmn1r171 UTSW 7 23633004 missense probably damaging 1.00
R6906:Vmn1r171 UTSW 7 23632379 missense probably benign 0.00
R7745:Vmn1r171 UTSW 7 23632610 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCAAAGATTGCAGCATATTCAGTCCC -3'
(R):5'- AGTTTCTCTGCATAACAGGCTCAGC -3'

Sequencing Primer
(F):5'- TATTCAGTCCCCCAATCAGAAG -3'
(R):5'- tctctctctctttctctctctctc -3'
Posted On2013-07-11