Incidental Mutation 'PIT4354001:Tbc1d31'
ID554832
Institutional Source Beutler Lab
Gene Symbol Tbc1d31
Ensembl Gene ENSMUSG00000022364
Gene NameTBC1 domain family, member 31
SynonymsLOC210544, Wdr67, D330013L20Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4354001 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location57912199-57970067 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57967933 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 929 (Y929C)
Ref Sequence ENSEMBL: ENSMUSP00000022992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022992]
Predicted Effect probably benign
Transcript: ENSMUST00000022992
AA Change: Y929C

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000022992
Gene: ENSMUSG00000022364
AA Change: Y929C

DomainStartEndE-ValueType
WD40 39 70 3.3e1 SMART
WD40 72 112 7.64e1 SMART
WD40 115 153 1.42e-4 SMART
WD40 156 196 1.03e1 SMART
WD40 199 242 6.6e1 SMART
Blast:WD40 245 292 8e-23 BLAST
WD40 295 334 2.48e0 SMART
Pfam:RabGAP-TBC 427 619 9.5e-11 PFAM
coiled coil region 699 844 N/A INTRINSIC
low complexity region 893 906 N/A INTRINSIC
low complexity region 974 985 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000124466
Gene: ENSMUSG00000022364
AA Change: Y166C

DomainStartEndE-ValueType
coiled coil region 97 124 N/A INTRINSIC
low complexity region 131 144 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
Coding Region Coverage
  • 1x: 92.5%
  • 3x: 90.1%
  • 10x: 83.2%
  • 20x: 69.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap2 A T 5: 62,654,049 Y1140N probably damaging Het
Ccdc83 A T 7: 90,223,974 M391K probably benign Het
Cntnap1 A T 11: 101,181,297 I459F probably damaging Het
Cr2 T A 1: 195,166,309 Y302F probably damaging Het
Ctu2 A T 8: 122,478,975 D179V probably damaging Het
Cubn G A 2: 13,468,852 Q427* probably null Het
Depdc7 A G 2: 104,728,188 S163P probably benign Het
Eif2s3y C T Y: 1,020,126 R385C probably benign Het
Gigyf1 A G 5: 137,524,104 K728R unknown Het
Gm1587 G A 14: 77,797,033 R32* probably null Het
Gm17689 T A 9: 36,581,301 S103C possibly damaging Het
Hfe2 T C 3: 96,528,445 C340R probably damaging Het
Isy1 A G 6: 87,833,671 I53T possibly damaging Het
Myh8 A T 11: 67,289,630 N564I probably benign Het
Neb A T 2: 52,245,318 I3260N probably damaging Het
Npc1 C T 18: 12,211,535 G426E probably benign Het
Nrd1 G A 4: 109,054,025 probably null Het
Olfr1221 C A 2: 89,112,486 E9* probably null Het
Olfr1257 T A 2: 89,881,508 S227R probably benign Het
Olfr56 G A 11: 49,134,305 V38M probably damaging Het
Prss51 T A 14: 64,097,097 V91D probably damaging Het
Qpct A C 17: 79,081,759 Y280S probably benign Het
Rbpms A G 8: 33,806,838 V137A possibly damaging Het
Rgl2 T A 17: 33,933,940 M441K possibly damaging Het
Sdhaf3 A T 6: 6,956,072 I16F possibly damaging Het
Slc38a3 T G 9: 107,657,649 N176H probably benign Het
Sos1 T C 17: 80,449,356 S256G possibly damaging Het
Spg11 A T 2: 122,088,185 C988S probably damaging Het
Sync A T 4: 129,306,654 Q451L possibly damaging Het
Thbs2 G A 17: 14,689,968 T123I probably damaging Het
Thsd7a A C 6: 12,331,927 probably null Het
Tnfrsf11a T C 1: 105,821,517 L220P probably damaging Het
Trbv13-2 G A 6: 41,121,818 C109Y probably damaging Het
Ugt3a1 G A 15: 9,306,360 W198* probably null Het
Usp14 G A 18: 9,996,189 R464W probably damaging Het
Vmn1r2 C T 4: 3,172,162 S27L probably benign Het
Vmn1r68 T A 7: 10,528,031 N47Y probably benign Het
Zfc3h1 T A 10: 115,427,039 Y1719* probably null Het
Other mutations in Tbc1d31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:Tbc1d31 APN 15 57940768 missense probably benign 0.03
IGL01955:Tbc1d31 APN 15 57942370 missense probably benign 0.24
IGL02024:Tbc1d31 APN 15 57919942 missense probably benign 0.10
IGL02501:Tbc1d31 APN 15 57937948 missense probably benign 0.11
IGL03133:Tbc1d31 APN 15 57942459 splice site probably benign
IGL03159:Tbc1d31 APN 15 57920048 critical splice donor site probably null
new_age UTSW 15 57951706 missense probably damaging 1.00
R0239:Tbc1d31 UTSW 15 57940753 missense probably benign 0.14
R0239:Tbc1d31 UTSW 15 57940753 missense probably benign 0.14
R0375:Tbc1d31 UTSW 15 57955350 missense probably benign
R0478:Tbc1d31 UTSW 15 57932536 missense probably damaging 1.00
R0576:Tbc1d31 UTSW 15 57969724 missense possibly damaging 0.79
R1328:Tbc1d31 UTSW 15 57942463 splice site probably benign
R1454:Tbc1d31 UTSW 15 57951638 nonsense probably null
R1784:Tbc1d31 UTSW 15 57963920 missense possibly damaging 0.86
R1874:Tbc1d31 UTSW 15 57916110 missense probably benign 0.41
R1920:Tbc1d31 UTSW 15 57912364 missense probably damaging 1.00
R2111:Tbc1d31 UTSW 15 57932644 missense probably benign 0.05
R2174:Tbc1d31 UTSW 15 57951741 missense possibly damaging 0.95
R2205:Tbc1d31 UTSW 15 57953520 missense probably benign 0.11
R3683:Tbc1d31 UTSW 15 57951814 critical splice donor site probably null
R3825:Tbc1d31 UTSW 15 57916078 missense probably benign 0.43
R4407:Tbc1d31 UTSW 15 57920042 missense possibly damaging 0.93
R4627:Tbc1d31 UTSW 15 57967912 missense probably benign
R4792:Tbc1d31 UTSW 15 57940728 missense probably benign 0.03
R4804:Tbc1d31 UTSW 15 57951106 nonsense probably null
R4909:Tbc1d31 UTSW 15 57962265 critical splice donor site probably null
R5077:Tbc1d31 UTSW 15 57955401 missense probably benign 0.00
R5230:Tbc1d31 UTSW 15 57960919 missense probably damaging 0.99
R5436:Tbc1d31 UTSW 15 57952871 missense probably benign 0.04
R5652:Tbc1d31 UTSW 15 57951666 missense probably damaging 1.00
R5920:Tbc1d31 UTSW 15 57942558 missense probably benign 0.10
R6102:Tbc1d31 UTSW 15 57936093 missense probably damaging 1.00
R6176:Tbc1d31 UTSW 15 57952796 missense probably damaging 0.99
R6513:Tbc1d31 UTSW 15 57955382 missense probably damaging 1.00
R6778:Tbc1d31 UTSW 15 57938029 missense probably damaging 1.00
R6795:Tbc1d31 UTSW 15 57951706 missense probably damaging 1.00
R7187:Tbc1d31 UTSW 15 57938063 missense possibly damaging 0.95
R7308:Tbc1d31 UTSW 15 57952816 missense probably damaging 1.00
R7359:Tbc1d31 UTSW 15 57916108 missense probably benign 0.00
R7453:Tbc1d31 UTSW 15 57950995 missense probably damaging 1.00
R7552:Tbc1d31 UTSW 15 57940740 missense probably benign
R7606:Tbc1d31 UTSW 15 57951670 missense probably damaging 1.00
R7739:Tbc1d31 UTSW 15 57936098 nonsense probably null
R7782:Tbc1d31 UTSW 15 57958368 missense possibly damaging 0.89
R8165:Tbc1d31 UTSW 15 57960949 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- TTCTGTGCAGCTCTGGATC -3'
(R):5'- TTCCCTACTGACAGTGCCCTAG -3'

Sequencing Primer
(F):5'- AGCTCTGGATCCCTGACAC -3'
(R):5'- CTACTGACAGTGCCCTAGGAAAG -3'
Posted On2019-06-07