Mutagenetix > Incidental Mutations

Incidental Mutation 'PIT4354001:Tbc1d31'

List |< first << previous [record 30 of 39] next >> last >|

554832

Institutional Source

Beutler Lab

Gene Symbol

Tbc1d31

Ensembl Gene

ENSMUSG00000022364

Gene Name

TBC1 domain family, member 31

Synonyms

LOC210544, Wdr67, D330013L20Rik

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

PIT4354001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

57912199-57970067 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 57967933 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 929 (Y929C)

Ref Sequence

ENSEMBL: ENSMUSP00000022992 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022992]

Predicted Effect

probably benign
Transcript: ENSMUST00000022992
AA Change: Y929C

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000022992
Gene: ENSMUSG00000022364
AA Change: Y929C

Domain	Start	End	E-Value	Type
WD40	39	70	3.3e1	SMART
WD40	72	112	7.64e1	SMART
WD40	115	153	1.42e-4	SMART
WD40	156	196	1.03e1	SMART
WD40	199	242	6.6e1	SMART
Blast:WD40	245	292	8e-23	BLAST
WD40	295	334	2.48e0	SMART
Pfam:RabGAP-TBC	427	619	9.5e-11	PFAM
coiled coil region	699	844	N/A	INTRINSIC
low complexity region	893	906	N/A	INTRINSIC
low complexity region	974	985	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000124466
Gene: ENSMUSG00000022364
AA Change: Y166C

Domain	Start	End	E-Value	Type
coiled coil region	97	124	N/A	INTRINSIC
low complexity region	131	144	N/A	INTRINSIC
low complexity region	212	223	N/A	INTRINSIC

Coding Region Coverage

1x: 92.5%
3x: 90.1%
10x: 83.2%
20x: 69.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arap2	A	T	5: 62,654,049	Y1140N	probably damaging	Het
Ccdc83	A	T	7: 90,223,974	M391K	probably benign	Het
Cntnap1	A	T	11: 101,181,297	I459F	probably damaging	Het
Cr2	T	A	1: 195,166,309	Y302F	probably damaging	Het
Ctu2	A	T	8: 122,478,975	D179V	probably damaging	Het
Cubn	G	A	2: 13,468,852	Q427*	probably null	Het
Depdc7	A	G	2: 104,728,188	S163P	probably benign	Het
Eif2s3y	C	T	Y: 1,020,126	R385C	probably benign	Het
Gigyf1	A	G	5: 137,524,104	K728R	unknown	Het
Gm1587	G	A	14: 77,797,033	R32*	probably null	Het
Gm17689	T	A	9: 36,581,301	S103C	possibly damaging	Het
Hfe2	T	C	3: 96,528,445	C340R	probably damaging	Het
Isy1	A	G	6: 87,833,671	I53T	possibly damaging	Het
Myh8	A	T	11: 67,289,630	N564I	probably benign	Het
Neb	A	T	2: 52,245,318	I3260N	probably damaging	Het
Npc1	C	T	18: 12,211,535	G426E	probably benign	Het
Nrd1	G	A	4: 109,054,025		probably null	Het
Olfr1221	C	A	2: 89,112,486	E9*	probably null	Het
Olfr1257	T	A	2: 89,881,508	S227R	probably benign	Het
Olfr56	G	A	11: 49,134,305	V38M	probably damaging	Het
Prss51	T	A	14: 64,097,097	V91D	probably damaging	Het
Qpct	A	C	17: 79,081,759	Y280S	probably benign	Het
Rbpms	A	G	8: 33,806,838	V137A	possibly damaging	Het
Rgl2	T	A	17: 33,933,940	M441K	possibly damaging	Het
Sdhaf3	A	T	6: 6,956,072	I16F	possibly damaging	Het
Slc38a3	T	G	9: 107,657,649	N176H	probably benign	Het
Sos1	T	C	17: 80,449,356	S256G	possibly damaging	Het
Spg11	A	T	2: 122,088,185	C988S	probably damaging	Het
Sync	A	T	4: 129,306,654	Q451L	possibly damaging	Het
Thbs2	G	A	17: 14,689,968	T123I	probably damaging	Het
Thsd7a	A	C	6: 12,331,927		probably null	Het
Tnfrsf11a	T	C	1: 105,821,517	L220P	probably damaging	Het
Trbv13-2	G	A	6: 41,121,818	C109Y	probably damaging	Het
Ugt3a1	G	A	15: 9,306,360	W198*	probably null	Het
Usp14	G	A	18: 9,996,189	R464W	probably damaging	Het
Vmn1r2	C	T	4: 3,172,162	S27L	probably benign	Het
Vmn1r68	T	A	7: 10,528,031	N47Y	probably benign	Het
Zfc3h1	T	A	10: 115,427,039	Y1719*	probably null	Het

Other mutations in Tbc1d31

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01433:Tbc1d31	APN	15	57940768	missense	probably benign	0.03
IGL01955:Tbc1d31	APN	15	57942370	missense	probably benign	0.24
IGL02024:Tbc1d31	APN	15	57919942	missense	probably benign	0.10
IGL02501:Tbc1d31	APN	15	57937948	missense	probably benign	0.11
IGL03133:Tbc1d31	APN	15	57942459	splice site	probably benign
IGL03159:Tbc1d31	APN	15	57920048	critical splice donor site	probably null
new_age	UTSW	15	57951706	missense	probably damaging	1.00
R0239:Tbc1d31	UTSW	15	57940753	missense	probably benign	0.14
R0239:Tbc1d31	UTSW	15	57940753	missense	probably benign	0.14
R0375:Tbc1d31	UTSW	15	57955350	missense	probably benign
R0478:Tbc1d31	UTSW	15	57932536	missense	probably damaging	1.00
R0576:Tbc1d31	UTSW	15	57969724	missense	possibly damaging	0.79
R1328:Tbc1d31	UTSW	15	57942463	splice site	probably benign
R1454:Tbc1d31	UTSW	15	57951638	nonsense	probably null
R1784:Tbc1d31	UTSW	15	57963920	missense	possibly damaging	0.86
R1874:Tbc1d31	UTSW	15	57916110	missense	probably benign	0.41
R1920:Tbc1d31	UTSW	15	57912364	missense	probably damaging	1.00
R2111:Tbc1d31	UTSW	15	57932644	missense	probably benign	0.05
R2174:Tbc1d31	UTSW	15	57951741	missense	possibly damaging	0.95
R2205:Tbc1d31	UTSW	15	57953520	missense	probably benign	0.11
R3683:Tbc1d31	UTSW	15	57951814	critical splice donor site	probably null
R3825:Tbc1d31	UTSW	15	57916078	missense	probably benign	0.43
R4407:Tbc1d31	UTSW	15	57920042	missense	possibly damaging	0.93
R4627:Tbc1d31	UTSW	15	57967912	missense	probably benign
R4792:Tbc1d31	UTSW	15	57940728	missense	probably benign	0.03
R4804:Tbc1d31	UTSW	15	57951106	nonsense	probably null
R4909:Tbc1d31	UTSW	15	57962265	critical splice donor site	probably null
R5077:Tbc1d31	UTSW	15	57955401	missense	probably benign	0.00
R5230:Tbc1d31	UTSW	15	57960919	missense	probably damaging	0.99
R5436:Tbc1d31	UTSW	15	57952871	missense	probably benign	0.04
R5652:Tbc1d31	UTSW	15	57951666	missense	probably damaging	1.00
R5920:Tbc1d31	UTSW	15	57942558	missense	probably benign	0.10
R6102:Tbc1d31	UTSW	15	57936093	missense	probably damaging	1.00
R6176:Tbc1d31	UTSW	15	57952796	missense	probably damaging	0.99
R6513:Tbc1d31	UTSW	15	57955382	missense	probably damaging	1.00
R6778:Tbc1d31	UTSW	15	57938029	missense	probably damaging	1.00
R6795:Tbc1d31	UTSW	15	57951706	missense	probably damaging	1.00
R7187:Tbc1d31	UTSW	15	57938063	missense	possibly damaging	0.95
R7308:Tbc1d31	UTSW	15	57952816	missense	probably damaging	1.00
R7359:Tbc1d31	UTSW	15	57916108	missense	probably benign	0.00
R7453:Tbc1d31	UTSW	15	57950995	missense	probably damaging	1.00
R7552:Tbc1d31	UTSW	15	57940740	missense	probably benign
R7606:Tbc1d31	UTSW	15	57951670	missense	probably damaging	1.00
R7739:Tbc1d31	UTSW	15	57936098	nonsense	probably null
R7782:Tbc1d31	UTSW	15	57958368	missense	possibly damaging	0.89
R8165:Tbc1d31	UTSW	15	57960949	missense	possibly damaging	0.74

Predicted Primers

PCR Primer
(F):5'- TTCTGTGCAGCTCTGGATC -3'
(R):5'- TTCCCTACTGACAGTGCCCTAG -3'

Sequencing Primer
(F):5'- AGCTCTGGATCCCTGACAC -3'
(R):5'- CTACTGACAGTGCCCTAGGAAAG -3'

Posted On

2019-06-07