Mutagenetix > Incidental Mutation

Incidental Mutation 'PIT4354001:Rgl2'

554834

Institutional Source

Beutler Lab

Gene Symbol

Rgl2

Ensembl Gene

ENSMUSG00000041354

Gene Name

ral guanine nucleotide dissociation stimulator-like 2

Synonyms

KE1.5, Rab2l, Rgt2, Rlf

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.154) question?

Stock #

PIT4354001 (G1)

Quality Score

192.009

Status

Not validated

Chromosome

Chromosomal Location

33929543-33937687 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 33933940 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 441 (M441K)

Ref Sequence

ENSEMBL: ENSMUSP00000041082 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025161] [ENSMUST00000025163] [ENSMUST00000047503] [ENSMUST00000173363] [ENSMUST00000174048] [ENSMUST00000179418]

AlphaFold

Q61193

PDB Structure

STRUCTURE DETERMINATION OF THE RAS-BINDING DOMAIN OF THE RAL-SPECIFIC GUANINE NUCLEOTIDE EXCHANGE FACTOR RLF, NMR, 10 STRUCTURES [SOLUTION NMR]
The conformation of a docking site for SH3 domains is pre-selected in the Guanine Nucleotide Exchange Factor Rlf [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000025161

SMART Domains

Protein: ENSMUSP00000025161
Gene: ENSMUSG00000024308

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
low complexity region	48	65	N/A	INTRINSIC
low complexity region	127	152	N/A	INTRINSIC
IG	168	292	3.45e0	SMART
IG_like	302	406	4.78e1	SMART
transmembrane domain	416	438	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000025163

SMART Domains

Protein: ENSMUSP00000025163
Gene: ENSMUSG00000024309

Domain	Start	End	E-Value	Type
Pfam:Prefoldin_2	10	115	9.6e-29	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000047503
AA Change: M441K

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000041082
Gene: ENSMUSG00000041354
AA Change: M441K

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	31	42	N/A	INTRINSIC
low complexity region	44	63	N/A	INTRINSIC
RasGEFN	87	212	9.54e-30	SMART
RasGEF	239	514	7.15e-106	SMART
low complexity region	578	592	N/A	INTRINSIC
low complexity region	602	619	N/A	INTRINSIC
low complexity region	633	648	N/A	INTRINSIC
RA	649	736	2.05e-19	SMART
low complexity region	737	762	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000134312
Gene: ENSMUSG00000041354
AA Change: M5K

Domain	Start	End	E-Value	Type
Blast:RasGEF	2	67	1e-35	BLAST
PDB:4JGW\|B	2	67	1e-35	PDB
SCOP:d1bkds_	2	94	3e-16	SMART
low complexity region	131	145	N/A	INTRINSIC
low complexity region	155	172	N/A	INTRINSIC
low complexity region	186	201	N/A	INTRINSIC
RA	202	289	2.05e-19	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000173363

SMART Domains

Protein: ENSMUSP00000138662
Gene: ENSMUSG00000024309

Domain	Start	End	E-Value	Type
Pfam:Prefoldin_2	1	89	1.1e-24	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000174048

SMART Domains

Protein: ENSMUSP00000133656
Gene: ENSMUSG00000024309

Domain	Start	End	E-Value	Type
Pfam:Prefoldin_2	10	115	2e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000179418

SMART Domains

Protein: ENSMUSP00000137072
Gene: ENSMUSG00000024309

Domain	Start	End	E-Value	Type
Pfam:Prefoldin_2	10	115	2e-28	PFAM

Coding Region Coverage

1x: 92.5%
3x: 90.1%
10x: 83.2%
20x: 69.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arap2	A	T	5: 62,654,049	Y1140N	probably damaging	Het
Ccdc83	A	T	7: 90,223,974	M391K	probably benign	Het
Cntnap1	A	T	11: 101,181,297	I459F	probably damaging	Het
Cr2	T	A	1: 195,166,309	Y302F	probably damaging	Het
Ctu2	A	T	8: 122,478,975	D179V	probably damaging	Het
Cubn	G	A	2: 13,468,852	Q427*	probably null	Het
Depdc7	A	G	2: 104,728,188	S163P	probably benign	Het
Eif2s3y	C	T	Y: 1,020,126	R385C	probably benign	Het
Gigyf1	A	G	5: 137,524,104	K728R	unknown	Het
Gm1587	G	A	14: 77,797,033	R32*	probably null	Het
Gm17689	T	A	9: 36,581,301	S103C	possibly damaging	Het
Hfe2	T	C	3: 96,528,445	C340R	probably damaging	Het
Isy1	A	G	6: 87,833,671	I53T	possibly damaging	Het
Myh8	A	T	11: 67,289,630	N564I	probably benign	Het
Neb	A	T	2: 52,245,318	I3260N	probably damaging	Het
Npc1	C	T	18: 12,211,535	G426E	probably benign	Het
Nrd1	G	A	4: 109,054,025		probably null	Het
Olfr1221	C	A	2: 89,112,486	E9*	probably null	Het
Olfr1257	T	A	2: 89,881,508	S227R	probably benign	Het
Olfr56	G	A	11: 49,134,305	V38M	probably damaging	Het
Prss51	T	A	14: 64,097,097	V91D	probably damaging	Het
Qpct	A	C	17: 79,081,759	Y280S	probably benign	Het
Rbpms	A	G	8: 33,806,838	V137A	possibly damaging	Het
Sdhaf3	A	T	6: 6,956,072	I16F	possibly damaging	Het
Slc38a3	T	G	9: 107,657,649	N176H	probably benign	Het
Sos1	T	C	17: 80,449,356	S256G	possibly damaging	Het
Spg11	A	T	2: 122,088,185	C988S	probably damaging	Het
Sync	A	T	4: 129,306,654	Q451L	possibly damaging	Het
Tbc1d31	A	G	15: 57,967,933	Y929C	probably benign	Het
Thbs2	G	A	17: 14,689,968	T123I	probably damaging	Het
Thsd7a	A	C	6: 12,331,927		probably null	Het
Tnfrsf11a	T	C	1: 105,821,517	L220P	probably damaging	Het
Trbv13-2	G	A	6: 41,121,818	C109Y	probably damaging	Het
Ugt3a1	G	A	15: 9,306,360	W198*	probably null	Het
Usp14	G	A	18: 9,996,189	R464W	probably damaging	Het
Vmn1r2	C	T	4: 3,172,162	S27L	probably benign	Het
Vmn1r68	T	A	7: 10,528,031	N47Y	probably benign	Het
Zfc3h1	T	A	10: 115,427,039	Y1719*	probably null	Het

Other mutations in Rgl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00514:Rgl2	APN	17	33933136	missense	probably benign	0.31
IGL00898:Rgl2	APN	17	33933418	missense	possibly damaging	0.95
IGL00965:Rgl2	APN	17	33935936	missense	probably benign	0.00
IGL00985:Rgl2	APN	17	33932101	missense	probably damaging	1.00
IGL02140:Rgl2	APN	17	33933124	missense	probably damaging	1.00
IGL02214:Rgl2	APN	17	33935189	missense	probably benign	0.06
IGL02486:Rgl2	APN	17	33935980	missense	probably damaging	0.97
IGL02579:Rgl2	APN	17	33937160	missense	probably benign	0.08
IGL02976:Rgl2	APN	17	33933962	missense	possibly damaging	0.95
Hypotenuse	UTSW	17	33931739	missense	probably benign	0.00
Pedernales	UTSW	17	33932038	critical splice acceptor site	probably null
R0347:Rgl2	UTSW	17	33932738	missense	probably damaging	1.00
R0456:Rgl2	UTSW	17	33936849	splice site	probably null
R0825:Rgl2	UTSW	17	33935159	splice site	probably null
R1742:Rgl2	UTSW	17	33937223	splice site	probably null
R1777:Rgl2	UTSW	17	33931744	missense	probably benign	0.00
R1829:Rgl2	UTSW	17	33933621	missense	probably benign	0.00
R1908:Rgl2	UTSW	17	33932148	missense	probably benign	0.00
R1961:Rgl2	UTSW	17	33933615	missense	probably damaging	1.00
R2102:Rgl2	UTSW	17	33933340	splice site	probably null
R3001:Rgl2	UTSW	17	33932605	missense	probably benign	0.00
R3002:Rgl2	UTSW	17	33932605	missense	probably benign	0.00
R3755:Rgl2	UTSW	17	33932597	missense	probably benign	0.01
R3756:Rgl2	UTSW	17	33932597	missense	probably benign	0.01
R3978:Rgl2	UTSW	17	33935162	missense	probably benign	0.02
R4042:Rgl2	UTSW	17	33937262	missense	probably damaging	1.00
R4064:Rgl2	UTSW	17	33937108	missense	possibly damaging	0.77
R4204:Rgl2	UTSW	17	33936932	missense	probably benign	0.04
R4661:Rgl2	UTSW	17	33933226	missense	possibly damaging	0.77
R4852:Rgl2	UTSW	17	33937173	missense	probably benign	0.00
R4922:Rgl2	UTSW	17	33932775	unclassified	probably benign
R5119:Rgl2	UTSW	17	33937120	missense	probably benign	0.00
R5167:Rgl2	UTSW	17	33935974	nonsense	probably null
R5279:Rgl2	UTSW	17	33935948	missense	probably benign
R5319:Rgl2	UTSW	17	33933555	missense	probably benign	0.02
R5337:Rgl2	UTSW	17	33934984	missense	probably damaging	0.99
R5881:Rgl2	UTSW	17	33932717	missense	probably benign	0.01
R5945:Rgl2	UTSW	17	33932038	critical splice acceptor site	probably null
R6165:Rgl2	UTSW	17	33931765	missense	probably benign	0.01
R6358:Rgl2	UTSW	17	33937131	splice site	probably null
R6867:Rgl2	UTSW	17	33932687	missense	probably benign	0.09
R7174:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7182:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7183:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7184:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7196:Rgl2	UTSW	17	33933429	missense	probably damaging	1.00
R7203:Rgl2	UTSW	17	33933429	missense	probably damaging	1.00
R7250:Rgl2	UTSW	17	33933429	missense	probably damaging	1.00
R7253:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7254:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7255:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7256:Rgl2	UTSW	17	33934990	missense	possibly damaging	0.93
R7282:Rgl2	UTSW	17	33933429	missense	probably damaging	1.00
R7455:Rgl2	UTSW	17	33932683	missense	probably benign	0.32
R7513:Rgl2	UTSW	17	33932555	missense	probably benign
R7752:Rgl2	UTSW	17	33935825	missense	possibly damaging	0.82
R7901:Rgl2	UTSW	17	33935825	missense	possibly damaging	0.82
R7941:Rgl2	UTSW	17	33931739	missense	probably benign	0.00
R8158:Rgl2	UTSW	17	33936944	missense	probably benign	0.27
R8209:Rgl2	UTSW	17	33932527	missense	possibly damaging	0.91
R8226:Rgl2	UTSW	17	33932527	missense	possibly damaging	0.91
R8405:Rgl2	UTSW	17	33933724	nonsense	probably null
R8871:Rgl2	UTSW	17	33935000	missense	probably damaging	1.00
R9205:Rgl2	UTSW	17	33936028	missense	probably damaging	1.00
R9591:Rgl2	UTSW	17	33932477	missense	possibly damaging	0.50
X0028:Rgl2	UTSW	17	33932458	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- ACCTTGCTTTGTCACCAGGAAG -3'
(R):5'- ACATGTTGAGTCACCCAGGG -3'

Sequencing Primer
(F):5'- TCACCAGGAAGTGAAGCCGC -3'
(R):5'- TTGAGTCACCCAGGGCAGATC -3'

Posted On

2019-06-07