Incidental Mutation 'PIT4354001:Usp14'
List |< first << previous [record 36 of 39] next >> last >|
ID554837
Institutional Source Beutler Lab
Gene Symbol Usp14
Ensembl Gene ENSMUSG00000047879
Gene Nameubiquitin specific peptidase 14
Synonyms2610005K12Rik, ataxia, NMF375, nmf375, dUB-type TGT, ax, 2610037B11Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4354001 (G1)
Quality Score164.009
Status Not validated
Chromosome18
Chromosomal Location9995432-10045119 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 9996189 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 464 (R464W)
Ref Sequence ENSEMBL: ENSMUSP00000089728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025137] [ENSMUST00000092096] [ENSMUST00000116669]
PDB Structure
Solution Structure of the N-terminal Ubiquitin-like Domain of Mouse Ubiquitin Specific Protease 14 (USP14) [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000025137
SMART Domains Protein: ENSMUSP00000025137
Gene: ENSMUSG00000024287

DomainStartEndE-ValueType
Pfam:efThoc1 69 546 7.2e-149 PFAM
DEATH 560 653 1.27e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000092096
AA Change: R464W

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000089728
Gene: ENSMUSG00000047879
AA Change: R464W

DomainStartEndE-ValueType
UBQ 4 74 3.61e-11 SMART
Pfam:UCH 104 479 9e-57 PFAM
Pfam:UCH_1 105 456 3.2e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000116669
AA Change: R429W

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112368
Gene: ENSMUSG00000047879
AA Change: R429W

DomainStartEndE-ValueType
UBQ 4 73 2.63e-4 SMART
low complexity region 217 235 N/A INTRINSIC
Coding Region Coverage
  • 1x: 92.5%
  • 3x: 90.1%
  • 10x: 83.2%
  • 20x: 69.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ubiquitin-specific processing (UBP) family of proteases that is a deubiquitinating enzyme (DUB) with His and Cys domains. This protein is located in the cytoplasm and cleaves the ubiquitin moiety from ubiquitin-fused precursors and ubiquitinylated proteins. Mice with a mutation that results in reduced expression of the ortholog of this protein are retarded for growth, develop severe tremors by 2 to 3 weeks of age followed by hindlimb paralysis and death by 6 to 10 weeks of age. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a hypomorphic mutation develop severe tremors by 3 weeks of age, followed by hindlimb paralysis and premature death. An underdeveloped corpus callosum, hippocampus, dentate gyrus and forebrain structures, and notable defects in synaptic transmission in both the CNS and PNS are seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap2 A T 5: 62,654,049 Y1140N probably damaging Het
Ccdc83 A T 7: 90,223,974 M391K probably benign Het
Cntnap1 A T 11: 101,181,297 I459F probably damaging Het
Cr2 T A 1: 195,166,309 Y302F probably damaging Het
Ctu2 A T 8: 122,478,975 D179V probably damaging Het
Cubn G A 2: 13,468,852 Q427* probably null Het
Depdc7 A G 2: 104,728,188 S163P probably benign Het
Eif2s3y C T Y: 1,020,126 R385C probably benign Het
Gigyf1 A G 5: 137,524,104 K728R unknown Het
Gm1587 G A 14: 77,797,033 R32* probably null Het
Gm17689 T A 9: 36,581,301 S103C possibly damaging Het
Hfe2 T C 3: 96,528,445 C340R probably damaging Het
Isy1 A G 6: 87,833,671 I53T possibly damaging Het
Myh8 A T 11: 67,289,630 N564I probably benign Het
Neb A T 2: 52,245,318 I3260N probably damaging Het
Npc1 C T 18: 12,211,535 G426E probably benign Het
Nrd1 G A 4: 109,054,025 probably null Het
Olfr1221 C A 2: 89,112,486 E9* probably null Het
Olfr1257 T A 2: 89,881,508 S227R probably benign Het
Olfr56 G A 11: 49,134,305 V38M probably damaging Het
Prss51 T A 14: 64,097,097 V91D probably damaging Het
Qpct A C 17: 79,081,759 Y280S probably benign Het
Rbpms A G 8: 33,806,838 V137A possibly damaging Het
Rgl2 T A 17: 33,933,940 M441K possibly damaging Het
Sdhaf3 A T 6: 6,956,072 I16F possibly damaging Het
Slc38a3 T G 9: 107,657,649 N176H probably benign Het
Sos1 T C 17: 80,449,356 S256G possibly damaging Het
Spg11 A T 2: 122,088,185 C988S probably damaging Het
Sync A T 4: 129,306,654 Q451L possibly damaging Het
Tbc1d31 A G 15: 57,967,933 Y929C probably benign Het
Thbs2 G A 17: 14,689,968 T123I probably damaging Het
Thsd7a A C 6: 12,331,927 probably null Het
Tnfrsf11a T C 1: 105,821,517 L220P probably damaging Het
Trbv13-2 G A 6: 41,121,818 C109Y probably damaging Het
Ugt3a1 G A 15: 9,306,360 W198* probably null Het
Vmn1r2 C T 4: 3,172,162 S27L probably benign Het
Vmn1r68 T A 7: 10,528,031 N47Y probably benign Het
Zfc3h1 T A 10: 115,427,039 Y1719* probably null Het
Other mutations in Usp14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02671:Usp14 APN 18 9997196 missense probably damaging 0.99
IGL02756:Usp14 APN 18 10001769 critical splice donor site probably null
R1238:Usp14 UTSW 18 9997763 missense probably benign
R1343:Usp14 UTSW 18 10016623 missense probably benign 0.03
R1365:Usp14 UTSW 18 10000490 splice site probably null
R1495:Usp14 UTSW 18 10004994 missense probably benign 0.01
R1817:Usp14 UTSW 18 10024673 missense probably damaging 1.00
R2021:Usp14 UTSW 18 10024632 missense probably damaging 0.99
R2190:Usp14 UTSW 18 10007835 missense probably damaging 1.00
R3836:Usp14 UTSW 18 10024532 critical splice donor site probably null
R3837:Usp14 UTSW 18 10024532 critical splice donor site probably null
R3838:Usp14 UTSW 18 10024532 critical splice donor site probably null
R3839:Usp14 UTSW 18 10024532 critical splice donor site probably null
R3870:Usp14 UTSW 18 10002370 missense possibly damaging 0.89
R3871:Usp14 UTSW 18 10002370 missense possibly damaging 0.89
R5388:Usp14 UTSW 18 10018023 missense probably damaging 1.00
R5767:Usp14 UTSW 18 10009935 intron probably benign
R5871:Usp14 UTSW 18 9996234 missense probably benign 0.27
R5898:Usp14 UTSW 18 10022819 missense possibly damaging 0.62
R7899:Usp14 UTSW 18 10000563 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- CACAAGTGGCTTGGTTCTGTTC -3'
(R):5'- CGTGAAATCATATTGAACCTGCATG -3'

Sequencing Primer
(F):5'- TGTTCTCATTTTCTTTAGAGCTCAAG -3'
(R):5'- ATGGTCCCTGGGCCATGTC -3'
Posted On2019-06-07