Incidental Mutation 'PIT4354001:Eif2s3y'
ID554839
Institutional Source Beutler Lab
Gene Symbol Eif2s3y
Ensembl Gene ENSMUSG00000069049
Gene Nameeukaryotic translation initiation factor 2, subunit 3, structural gene Y-linked
SynonymsTfy, Spy, Eif-2gy
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.040) question?
Stock #PIT4354001 (G1)
Quality Score222.016
Status Not validated
ChromosomeY
Chromosomal Location1010543-1028847 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 1020126 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 385 (R385C)
Ref Sequence ENSEMBL: ENSMUSP00000088736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091197]
Predicted Effect probably benign
Transcript: ENSMUST00000091197
AA Change: R385C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000088736
Gene: ENSMUSG00000069049
AA Change: R385C

DomainStartEndE-ValueType
Pfam:GTP_EFTU 39 245 1.9e-23 PFAM
Pfam:GTP_EFTU_D2 276 359 2.1e-13 PFAM
Pfam:eIF2_C 369 459 1.4e-39 PFAM
Coding Region Coverage
  • 1x: 92.5%
  • 3x: 90.1%
  • 10x: 83.2%
  • 20x: 69.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Hemizygous knockout leads to male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap2 A T 5: 62,654,049 Y1140N probably damaging Het
Ccdc83 A T 7: 90,223,974 M391K probably benign Het
Cntnap1 A T 11: 101,181,297 I459F probably damaging Het
Cr2 T A 1: 195,166,309 Y302F probably damaging Het
Ctu2 A T 8: 122,478,975 D179V probably damaging Het
Cubn G A 2: 13,468,852 Q427* probably null Het
Depdc7 A G 2: 104,728,188 S163P probably benign Het
Gigyf1 A G 5: 137,524,104 K728R unknown Het
Gm1587 G A 14: 77,797,033 R32* probably null Het
Gm17689 T A 9: 36,581,301 S103C possibly damaging Het
Hfe2 T C 3: 96,528,445 C340R probably damaging Het
Isy1 A G 6: 87,833,671 I53T possibly damaging Het
Myh8 A T 11: 67,289,630 N564I probably benign Het
Neb A T 2: 52,245,318 I3260N probably damaging Het
Npc1 C T 18: 12,211,535 G426E probably benign Het
Nrd1 G A 4: 109,054,025 probably null Het
Olfr1221 C A 2: 89,112,486 E9* probably null Het
Olfr1257 T A 2: 89,881,508 S227R probably benign Het
Olfr56 G A 11: 49,134,305 V38M probably damaging Het
Prss51 T A 14: 64,097,097 V91D probably damaging Het
Qpct A C 17: 79,081,759 Y280S probably benign Het
Rbpms A G 8: 33,806,838 V137A possibly damaging Het
Rgl2 T A 17: 33,933,940 M441K possibly damaging Het
Sdhaf3 A T 6: 6,956,072 I16F possibly damaging Het
Slc38a3 T G 9: 107,657,649 N176H probably benign Het
Sos1 T C 17: 80,449,356 S256G possibly damaging Het
Spg11 A T 2: 122,088,185 C988S probably damaging Het
Sync A T 4: 129,306,654 Q451L possibly damaging Het
Tbc1d31 A G 15: 57,967,933 Y929C probably benign Het
Thbs2 G A 17: 14,689,968 T123I probably damaging Het
Thsd7a A C 6: 12,331,927 probably null Het
Tnfrsf11a T C 1: 105,821,517 L220P probably damaging Het
Trbv13-2 G A 6: 41,121,818 C109Y probably damaging Het
Ugt3a1 G A 15: 9,306,360 W198* probably null Het
Usp14 G A 18: 9,996,189 R464W probably damaging Het
Vmn1r2 C T 4: 3,172,162 S27L probably benign Het
Vmn1r68 T A 7: 10,528,031 N47Y probably benign Het
Zfc3h1 T A 10: 115,427,039 Y1719* probably null Het
Other mutations in Eif2s3y
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1778:Eif2s3y UTSW Y 1011287 missense probably benign 0.31
R2967:Eif2s3y UTSW Y 1020030 missense probably benign
R3941:Eif2s3y UTSW Y 1012079 missense probably benign 0.04
R4956:Eif2s3y UTSW Y 1023407 missense possibly damaging 0.92
R5457:Eif2s3y UTSW Y 1016057 missense probably damaging 0.96
R5572:Eif2s3y UTSW Y 1016631 missense probably damaging 0.96
R5913:Eif2s3y UTSW Y 1017365 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- GACCAAATGAGTTAGTTTTAGAGATCT -3'
(R):5'- CACTCACATGACATTTTACAAAACAT -3'

Sequencing Primer
(F):5'- GAGATCTTTGGAGATATTAGT -3'
(R):5'- GCTGTTAAGAGCACCGACTGTTC -3'
Posted On2019-06-07