Incidental Mutation 'PIT4480001:Tgfbr1'
ID554849
Institutional Source Beutler Lab
Gene Symbol Tgfbr1
Ensembl Gene ENSMUSG00000007613
Gene Nametransforming growth factor, beta receptor I
SynonymsTbetaRI, ALK5, TbetaR-I, Alk-5
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4480001 (G1)
Quality Score180.009
Status Not validated
Chromosome4
Chromosomal Location47353222-47414931 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 47402955 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 320 (I320V)
Ref Sequence ENSEMBL: ENSMUSP00000007757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007757] [ENSMUST00000044234] [ENSMUST00000107725] [ENSMUST00000126171]
Predicted Effect probably benign
Transcript: ENSMUST00000007757
AA Change: I320V

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000007757
Gene: ENSMUSG00000007613
AA Change: I320V

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 13 24 N/A INTRINSIC
Pfam:Activin_recp 30 110 2.7e-16 PFAM
transmembrane domain 126 148 N/A INTRINSIC
GS 175 205 1.01e-14 SMART
Blast:STYKc 207 492 7e-31 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000044234
AA Change: I316V

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000048501
Gene: ENSMUSG00000007613
AA Change: I316V

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 13 24 N/A INTRINSIC
Pfam:Activin_recp 30 110 1.6e-14 PFAM
transmembrane domain 122 144 N/A INTRINSIC
GS 171 201 1.01e-14 SMART
Blast:STYKc 203 488 8e-31 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000107725
AA Change: I237V

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103353
Gene: ENSMUSG00000007613
AA Change: I237V

DomainStartEndE-ValueType
transmembrane domain 43 65 N/A INTRINSIC
GS 92 122 1.01e-14 SMART
Blast:STYKc 124 409 3e-31 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000126171
AA Change: I251V

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000123761
Gene: ENSMUSG00000007613
AA Change: I251V

DomainStartEndE-ValueType
PDB:3KFD|L 1 45 3e-26 PDB
transmembrane domain 57 79 N/A INTRINSIC
GS 106 136 1.01e-14 SMART
Blast:STYKc 138 423 3e-31 BLAST
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.7%
  • 10x: 83.8%
  • 20x: 69.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the transforming growth factor beta (TGF-beta) receptor family of proteins. These proteins comprise one component of the TGF-beta signaling pathway, which transduces extracellular signals into gene expression changes to regulate a wide range of cellular responses, including proliferation, migration, differentiation and apoptosis. Homozygous knockout mice for this gene exhibit impaired angiogenesis and embryonic lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygotes for some targeted null mutations exhibit defects of the yolk sac and placenta, lack circulating erythrocytes, and die at midgestation. Mutant endothelial cells show enhanced proliferation, improper migration, and reduced fibronectin production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,283,752 M4475V probably benign Het
Actn3 G A 19: 4,867,577 Q413* probably null Het
Ahnak2 C T 12: 112,773,924 S1238N possibly damaging Het
Arsk T C 13: 76,062,365 E521G probably damaging Het
Baiap2 A G 11: 119,997,087 T356A probably benign Het
Baz1b G A 5: 135,217,965 R756H probably damaging Het
Celsr1 G A 15: 86,032,414 P453S probably damaging Het
Cep41 G A 6: 30,658,413 P196S probably damaging Het
Cln5 T A 14: 103,071,778 Y89* probably null Het
Cntnap3 A G 13: 64,757,210 F919S probably damaging Het
Cntrl C T 2: 35,155,428 H1383Y probably damaging Het
Cobl A G 11: 12,253,592 S1037P probably benign Het
Col17a1 A T 19: 47,671,374 S380T probably benign Het
Dagla A T 19: 10,260,658 S323T probably benign Het
Dicer1 G T 12: 104,696,544 Q1593K probably benign Het
Dnah6 T C 6: 73,101,880 I2367V probably benign Het
Emc1 T C 4: 139,359,277 S184P possibly damaging Het
Eps8l1 G A 7: 4,471,415 S295N probably benign Het
Erbb4 A T 1: 68,075,543 M914K probably damaging Het
Eva1a A G 6: 82,091,803 E37G probably damaging Het
Fam49b G A 15: 63,956,641 T11I probably benign Het
Fyco1 G T 9: 123,828,650 Y820* probably null Het
Gipr T C 7: 19,162,934 Y137C probably damaging Het
Gm5414 A G 15: 101,627,746 V148A probably damaging Het
Gpn1 T C 5: 31,497,341 V79A probably damaging Het
Grk2 G A 19: 4,287,409 R617C possibly damaging Het
Inpp4b A C 8: 82,046,267 E730A probably damaging Het
Inpp5f C T 7: 128,685,134 T579I probably benign Het
Kif15 A T 9: 123,011,543 M1201L probably benign Het
Ltbp3 A G 19: 5,751,226 N631S possibly damaging Het
Mdh1 G A 11: 21,558,538 S268L probably damaging Het
Mgat4e T A 1: 134,541,365 T314S possibly damaging Het
Nsd1 A G 13: 55,213,918 Q233R probably benign Het
Olfr1141 T C 2: 87,753,783 D70G possibly damaging Het
Olfr738 T C 14: 50,413,915 F124L probably benign Het
Paqr5 T A 9: 61,956,156 I295L probably benign Het
Peg10 C T 6: 4,756,560 H379Y unknown Het
Phtf2 A T 5: 20,813,244 I33N probably damaging Het
Plcb2 T C 2: 118,723,496 M115V probably benign Het
Ppp2r3a A G 9: 101,126,377 Y431H possibly damaging Het
Prph2 GT G 17: 46,911,113 probably null Het
Psmd1 C T 1: 86,128,238 P774L probably damaging Het
Ranbp17 A T 11: 33,297,340 probably null Het
Rptn A G 3: 93,397,670 D770G possibly damaging Het
Serac1 A G 17: 6,050,812 L439P probably damaging Het
Slitrk6 TTTTAGTCTGTTCTACCAACACCTT TTT 14: 110,749,825 probably null Het
Sox6 T C 7: 115,597,509 I295M probably benign Het
Sulf1 T A 1: 12,859,413 D301E probably benign Het
Tas2r117 G A 6: 132,803,051 V51I possibly damaging Het
Tbx2 C T 11: 85,834,735 R171C probably damaging Het
Tjp3 C A 10: 81,279,257 G396W probably damaging Het
Tmprss2 T C 16: 97,599,260 N4D possibly damaging Het
Tnfaip3 T C 10: 19,007,323 N165D probably benign Het
Tnfrsf21 A T 17: 43,037,911 Y138F probably benign Het
Utp4 T C 8: 106,906,185 S267P probably benign Het
Wnk1 A T 6: 119,963,367 L803* probably null Het
Zbbx T A 3: 75,136,487 D35V probably damaging Het
Zscan12 T G 13: 21,368,574 N189K possibly damaging Het
Other mutations in Tgfbr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Tgfbr1 APN 4 47383992 missense probably benign 0.00
IGL00757:Tgfbr1 APN 4 47405581 missense probably damaging 1.00
IGL02001:Tgfbr1 APN 4 47403388 missense probably damaging 1.00
IGL02207:Tgfbr1 APN 4 47410785 utr 3 prime probably benign
IGL02338:Tgfbr1 APN 4 47393490 critical splice donor site probably null
R0097:Tgfbr1 UTSW 4 47403451 nonsense probably null
R0097:Tgfbr1 UTSW 4 47403451 nonsense probably null
R1299:Tgfbr1 UTSW 4 47396587 critical splice donor site probably null
R1444:Tgfbr1 UTSW 4 47393259 missense probably benign
R1530:Tgfbr1 UTSW 4 47410688 missense probably damaging 1.00
R1591:Tgfbr1 UTSW 4 47403471 missense probably damaging 1.00
R1611:Tgfbr1 UTSW 4 47396526 missense probably damaging 1.00
R2327:Tgfbr1 UTSW 4 47402833 missense probably damaging 1.00
R4352:Tgfbr1 UTSW 4 47402863 missense probably damaging 1.00
R4736:Tgfbr1 UTSW 4 47383835 missense probably benign
R5180:Tgfbr1 UTSW 4 47383948 nonsense probably null
R5907:Tgfbr1 UTSW 4 47396555 missense probably damaging 1.00
R6462:Tgfbr1 UTSW 4 47402846 missense probably damaging 1.00
R6842:Tgfbr1 UTSW 4 47383757 missense probably damaging 1.00
R7017:Tgfbr1 UTSW 4 47410728 missense probably damaging 0.99
R7206:Tgfbr1 UTSW 4 47402941 missense probably damaging 1.00
R7402:Tgfbr1 UTSW 4 47405623 missense probably damaging 1.00
R7862:Tgfbr1 UTSW 4 47403489 missense probably damaging 0.99
R8210:Tgfbr1 UTSW 4 47406924 missense probably benign 0.01
RF013:Tgfbr1 UTSW 4 47353354 missense unknown
Z1176:Tgfbr1 UTSW 4 47353790 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AAATGTATGTGTTCTGACGTGC -3'
(R):5'- GCAAACCACTGTGTCGAAAGG -3'

Sequencing Primer
(F):5'- TGACGTGCAGACAATGGGAC -3'
(R):5'- CCACTGTGTCGAAAGGGAAGAAATC -3'
Posted On2019-06-07