Incidental Mutation 'PIT4480001:Gpn1'
ID554852
Institutional Source Beutler Lab
Gene Symbol Gpn1
Ensembl Gene ENSMUSG00000064037
Gene NameGPN-loop GTPase 1
Synonyms2410004J02Rik, Xab1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #PIT4480001 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location31494741-31512904 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31497341 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 79 (V79A)
Ref Sequence ENSEMBL: ENSMUSP00000076217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076949] [ENSMUST00000201053] [ENSMUST00000202394]
Predicted Effect probably damaging
Transcript: ENSMUST00000076949
AA Change: V79A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076217
Gene: ENSMUSG00000064037
AA Change: V79A

DomainStartEndE-ValueType
AAA 18 182 9.44e-4 SMART
low complexity region 263 275 N/A INTRINSIC
low complexity region 330 344 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201053
SMART Domains Protein: ENSMUSP00000144015
Gene: ENSMUSG00000064037

DomainStartEndE-ValueType
Pfam:ATP_bind_1 24 73 1.2e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000202394
AA Change: V79A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144105
Gene: ENSMUSG00000064037
AA Change: V79A

DomainStartEndE-ValueType
Pfam:ATP_bind_1 24 87 1.8e-26 PFAM
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.7%
  • 10x: 83.8%
  • 20x: 69.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a guanosine triphosphatase enzyme. The encoded protein may play a role in DNA repair and may function in activation of transcription. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,283,752 M4475V probably benign Het
Actn3 G A 19: 4,867,577 Q413* probably null Het
Ahnak2 C T 12: 112,773,924 S1238N possibly damaging Het
Arsk T C 13: 76,062,365 E521G probably damaging Het
Baiap2 A G 11: 119,997,087 T356A probably benign Het
Baz1b G A 5: 135,217,965 R756H probably damaging Het
Celsr1 G A 15: 86,032,414 P453S probably damaging Het
Cep41 G A 6: 30,658,413 P196S probably damaging Het
Cln5 T A 14: 103,071,778 Y89* probably null Het
Cntnap3 A G 13: 64,757,210 F919S probably damaging Het
Cntrl C T 2: 35,155,428 H1383Y probably damaging Het
Cobl A G 11: 12,253,592 S1037P probably benign Het
Col17a1 A T 19: 47,671,374 S380T probably benign Het
Dagla A T 19: 10,260,658 S323T probably benign Het
Dicer1 G T 12: 104,696,544 Q1593K probably benign Het
Dnah6 T C 6: 73,101,880 I2367V probably benign Het
Emc1 T C 4: 139,359,277 S184P possibly damaging Het
Eps8l1 G A 7: 4,471,415 S295N probably benign Het
Erbb4 A T 1: 68,075,543 M914K probably damaging Het
Eva1a A G 6: 82,091,803 E37G probably damaging Het
Fam49b G A 15: 63,956,641 T11I probably benign Het
Fyco1 G T 9: 123,828,650 Y820* probably null Het
Gipr T C 7: 19,162,934 Y137C probably damaging Het
Gm5414 A G 15: 101,627,746 V148A probably damaging Het
Grk2 G A 19: 4,287,409 R617C possibly damaging Het
Inpp4b A C 8: 82,046,267 E730A probably damaging Het
Inpp5f C T 7: 128,685,134 T579I probably benign Het
Kif15 A T 9: 123,011,543 M1201L probably benign Het
Ltbp3 A G 19: 5,751,226 N631S possibly damaging Het
Mdh1 G A 11: 21,558,538 S268L probably damaging Het
Mgat4e T A 1: 134,541,365 T314S possibly damaging Het
Nsd1 A G 13: 55,213,918 Q233R probably benign Het
Olfr1141 T C 2: 87,753,783 D70G possibly damaging Het
Olfr738 T C 14: 50,413,915 F124L probably benign Het
Paqr5 T A 9: 61,956,156 I295L probably benign Het
Peg10 C T 6: 4,756,560 H379Y unknown Het
Phtf2 A T 5: 20,813,244 I33N probably damaging Het
Plcb2 T C 2: 118,723,496 M115V probably benign Het
Ppp2r3a A G 9: 101,126,377 Y431H possibly damaging Het
Prph2 GT G 17: 46,911,113 probably null Het
Psmd1 C T 1: 86,128,238 P774L probably damaging Het
Ranbp17 A T 11: 33,297,340 probably null Het
Rptn A G 3: 93,397,670 D770G possibly damaging Het
Serac1 A G 17: 6,050,812 L439P probably damaging Het
Slitrk6 TTTTAGTCTGTTCTACCAACACCTT TTT 14: 110,749,825 probably null Het
Sox6 T C 7: 115,597,509 I295M probably benign Het
Sulf1 T A 1: 12,859,413 D301E probably benign Het
Tas2r117 G A 6: 132,803,051 V51I possibly damaging Het
Tbx2 C T 11: 85,834,735 R171C probably damaging Het
Tgfbr1 A G 4: 47,402,955 I320V probably benign Het
Tjp3 C A 10: 81,279,257 G396W probably damaging Het
Tmprss2 T C 16: 97,599,260 N4D possibly damaging Het
Tnfaip3 T C 10: 19,007,323 N165D probably benign Het
Tnfrsf21 A T 17: 43,037,911 Y138F probably benign Het
Utp4 T C 8: 106,906,185 S267P probably benign Het
Wnk1 A T 6: 119,963,367 L803* probably null Het
Zbbx T A 3: 75,136,487 D35V probably damaging Het
Zscan12 T G 13: 21,368,574 N189K possibly damaging Het
Other mutations in Gpn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Gpn1 APN 5 31498401 missense probably damaging 0.99
IGL01431:Gpn1 APN 5 31507538 missense probably benign 0.00
IGL01673:Gpn1 APN 5 31494835 missense probably damaging 1.00
IGL01921:Gpn1 APN 5 31499268 missense probably damaging 0.99
IGL03243:Gpn1 APN 5 31510831 critical splice acceptor site probably null
IGL03343:Gpn1 APN 5 31504965 missense probably damaging 1.00
PIT4585001:Gpn1 UTSW 5 31509403 nonsense probably null
R0001:Gpn1 UTSW 5 31495617 splice site probably benign
R1301:Gpn1 UTSW 5 31503429 missense probably damaging 1.00
R1583:Gpn1 UTSW 5 31497338 missense possibly damaging 0.46
R1622:Gpn1 UTSW 5 31503404 missense possibly damaging 0.85
R2860:Gpn1 UTSW 5 31497320 missense probably damaging 1.00
R2861:Gpn1 UTSW 5 31497320 missense probably damaging 1.00
R4603:Gpn1 UTSW 5 31497352 critical splice donor site probably null
R4627:Gpn1 UTSW 5 31498393 nonsense probably null
R5927:Gpn1 UTSW 5 31500891 missense probably damaging 1.00
R6613:Gpn1 UTSW 5 31497352 critical splice donor site probably null
R6830:Gpn1 UTSW 5 31507488 missense probably benign 0.00
R7214:Gpn1 UTSW 5 31503417 missense probably damaging 1.00
R7372:Gpn1 UTSW 5 31501121 missense probably damaging 0.99
X0062:Gpn1 UTSW 5 31495593 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTGGGGTACTACTTGGC -3'
(R):5'- GAGGCATTGCTGAAATCTCTG -3'

Sequencing Primer
(F):5'- GGTAAGATACGGTGGCACTTGTAC -3'
(R):5'- AAGAGGGCGTCAGATCTCTTTAC -3'
Posted On2019-06-07