Incidental Mutation 'PIT4480001:Eva1a'
ID554857
Institutional Source Beutler Lab
Gene Symbol Eva1a
Ensembl Gene ENSMUSG00000035104
Gene Nameeva-1 homolog A (C. elegans)
SynonymsTmem166, Fam176a
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.213) question?
Stock #PIT4480001 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location82041043-82093099 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82091803 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 37 (E37G)
Ref Sequence ENSEMBL: ENSMUSP00000037422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042974] [ENSMUST00000149023] [ENSMUST00000150976]
Predicted Effect probably damaging
Transcript: ENSMUST00000042974
AA Change: E37G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037422
Gene: ENSMUSG00000035104
AA Change: E37G

DomainStartEndE-ValueType
Pfam:FAM176 18 156 5.4e-61 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000149023
AA Change: E37G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117345
Gene: ENSMUSG00000035104
AA Change: E37G

DomainStartEndE-ValueType
Pfam:FAM176 18 155 3.1e-63 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000150976
AA Change: E37G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122674
Gene: ENSMUSG00000035104
AA Change: E37G

DomainStartEndE-ValueType
Pfam:FAM176 18 67 7.4e-26 PFAM
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.7%
  • 10x: 83.8%
  • 20x: 69.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,283,752 M4475V probably benign Het
Actn3 G A 19: 4,867,577 Q413* probably null Het
Ahnak2 C T 12: 112,773,924 S1238N possibly damaging Het
Arsk T C 13: 76,062,365 E521G probably damaging Het
Baiap2 A G 11: 119,997,087 T356A probably benign Het
Baz1b G A 5: 135,217,965 R756H probably damaging Het
Celsr1 G A 15: 86,032,414 P453S probably damaging Het
Cep41 G A 6: 30,658,413 P196S probably damaging Het
Cln5 T A 14: 103,071,778 Y89* probably null Het
Cntnap3 A G 13: 64,757,210 F919S probably damaging Het
Cntrl C T 2: 35,155,428 H1383Y probably damaging Het
Cobl A G 11: 12,253,592 S1037P probably benign Het
Col17a1 A T 19: 47,671,374 S380T probably benign Het
Dagla A T 19: 10,260,658 S323T probably benign Het
Dicer1 G T 12: 104,696,544 Q1593K probably benign Het
Dnah6 T C 6: 73,101,880 I2367V probably benign Het
Emc1 T C 4: 139,359,277 S184P possibly damaging Het
Eps8l1 G A 7: 4,471,415 S295N probably benign Het
Erbb4 A T 1: 68,075,543 M914K probably damaging Het
Fam49b G A 15: 63,956,641 T11I probably benign Het
Fyco1 G T 9: 123,828,650 Y820* probably null Het
Gipr T C 7: 19,162,934 Y137C probably damaging Het
Gm5414 A G 15: 101,627,746 V148A probably damaging Het
Gpn1 T C 5: 31,497,341 V79A probably damaging Het
Grk2 G A 19: 4,287,409 R617C possibly damaging Het
Inpp4b A C 8: 82,046,267 E730A probably damaging Het
Inpp5f C T 7: 128,685,134 T579I probably benign Het
Kif15 A T 9: 123,011,543 M1201L probably benign Het
Ltbp3 A G 19: 5,751,226 N631S possibly damaging Het
Mdh1 G A 11: 21,558,538 S268L probably damaging Het
Mgat4e T A 1: 134,541,365 T314S possibly damaging Het
Nsd1 A G 13: 55,213,918 Q233R probably benign Het
Olfr1141 T C 2: 87,753,783 D70G possibly damaging Het
Olfr738 T C 14: 50,413,915 F124L probably benign Het
Paqr5 T A 9: 61,956,156 I295L probably benign Het
Peg10 C T 6: 4,756,560 H379Y unknown Het
Phtf2 A T 5: 20,813,244 I33N probably damaging Het
Plcb2 T C 2: 118,723,496 M115V probably benign Het
Ppp2r3a A G 9: 101,126,377 Y431H possibly damaging Het
Prph2 GT G 17: 46,911,113 probably null Het
Psmd1 C T 1: 86,128,238 P774L probably damaging Het
Ranbp17 A T 11: 33,297,340 probably null Het
Rptn A G 3: 93,397,670 D770G possibly damaging Het
Serac1 A G 17: 6,050,812 L439P probably damaging Het
Slitrk6 TTTTAGTCTGTTCTACCAACACCTT TTT 14: 110,749,825 probably null Het
Sox6 T C 7: 115,597,509 I295M probably benign Het
Sulf1 T A 1: 12,859,413 D301E probably benign Het
Tas2r117 G A 6: 132,803,051 V51I possibly damaging Het
Tbx2 C T 11: 85,834,735 R171C probably damaging Het
Tgfbr1 A G 4: 47,402,955 I320V probably benign Het
Tjp3 C A 10: 81,279,257 G396W probably damaging Het
Tmprss2 T C 16: 97,599,260 N4D possibly damaging Het
Tnfaip3 T C 10: 19,007,323 N165D probably benign Het
Tnfrsf21 A T 17: 43,037,911 Y138F probably benign Het
Utp4 T C 8: 106,906,185 S267P probably benign Het
Wnk1 A T 6: 119,963,367 L803* probably null Het
Zbbx T A 3: 75,136,487 D35V probably damaging Het
Zscan12 T G 13: 21,368,574 N189K possibly damaging Het
Other mutations in Eva1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02738:Eva1a APN 6 82071230 missense probably benign 0.01
R0970:Eva1a UTSW 6 82092103 missense probably damaging 1.00
R1777:Eva1a UTSW 6 82092156 missense probably damaging 1.00
R1818:Eva1a UTSW 6 82071144 start codon destroyed probably null 0.30
R2200:Eva1a UTSW 6 82091913 missense probably benign 0.19
R5820:Eva1a UTSW 6 82071173 missense probably benign 0.22
R5921:Eva1a UTSW 6 82092159 missense probably damaging 1.00
R6373:Eva1a UTSW 6 82091866 missense probably damaging 1.00
R6450:Eva1a UTSW 6 82092105 missense probably damaging 1.00
R7094:Eva1a UTSW 6 82092043 missense probably damaging 1.00
R7148:Eva1a UTSW 6 82071144 start codon destroyed probably null 0.47
R7468:Eva1a UTSW 6 82092021 missense possibly damaging 0.55
R7503:Eva1a UTSW 6 82071229 nonsense probably null
R8193:Eva1a UTSW 6 82091940 missense probably benign 0.34
Z1088:Eva1a UTSW 6 82091937 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AAATTGCCGTATGTAGCCTTTG -3'
(R):5'- TTCAAAGTCCTCTCGAAGCGG -3'

Sequencing Primer
(F):5'- GTCTTCCAGCAATAGAATTCAGGGC -3'
(R):5'- AGGTCAGAGGCTGTGTCCTC -3'
Posted On2019-06-07