Incidental Mutation 'PIT4480001:Tas2r117'
ID554859
Institutional Source Beutler Lab
Gene Symbol Tas2r117
Ensembl Gene ENSMUSG00000058349
Gene Nametaste receptor, type 2, member 117
SynonymsTas2r17, T2R17, mt2r54, mGR17
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #PIT4480001 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location132802818-132803975 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 132803051 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 51 (V51I)
Ref Sequence ENSEMBL: ENSMUSP00000069768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068302]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068302
AA Change: V51I

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000069768
Gene: ENSMUSG00000058349
AA Change: V51I

DomainStartEndE-ValueType
Pfam:TAS2R 8 307 1.2e-85 PFAM
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.7%
  • 10x: 83.8%
  • 20x: 69.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,283,752 M4475V probably benign Het
Actn3 G A 19: 4,867,577 Q413* probably null Het
Ahnak2 C T 12: 112,773,924 S1238N possibly damaging Het
Arsk T C 13: 76,062,365 E521G probably damaging Het
Baiap2 A G 11: 119,997,087 T356A probably benign Het
Baz1b G A 5: 135,217,965 R756H probably damaging Het
Celsr1 G A 15: 86,032,414 P453S probably damaging Het
Cep41 G A 6: 30,658,413 P196S probably damaging Het
Cln5 T A 14: 103,071,778 Y89* probably null Het
Cntnap3 A G 13: 64,757,210 F919S probably damaging Het
Cntrl C T 2: 35,155,428 H1383Y probably damaging Het
Cobl A G 11: 12,253,592 S1037P probably benign Het
Col17a1 A T 19: 47,671,374 S380T probably benign Het
Dagla A T 19: 10,260,658 S323T probably benign Het
Dicer1 G T 12: 104,696,544 Q1593K probably benign Het
Dnah6 T C 6: 73,101,880 I2367V probably benign Het
Emc1 T C 4: 139,359,277 S184P possibly damaging Het
Eps8l1 G A 7: 4,471,415 S295N probably benign Het
Erbb4 A T 1: 68,075,543 M914K probably damaging Het
Eva1a A G 6: 82,091,803 E37G probably damaging Het
Fam49b G A 15: 63,956,641 T11I probably benign Het
Fyco1 G T 9: 123,828,650 Y820* probably null Het
Gipr T C 7: 19,162,934 Y137C probably damaging Het
Gm5414 A G 15: 101,627,746 V148A probably damaging Het
Gpn1 T C 5: 31,497,341 V79A probably damaging Het
Grk2 G A 19: 4,287,409 R617C possibly damaging Het
Inpp4b A C 8: 82,046,267 E730A probably damaging Het
Inpp5f C T 7: 128,685,134 T579I probably benign Het
Kif15 A T 9: 123,011,543 M1201L probably benign Het
Ltbp3 A G 19: 5,751,226 N631S possibly damaging Het
Mdh1 G A 11: 21,558,538 S268L probably damaging Het
Mgat4e T A 1: 134,541,365 T314S possibly damaging Het
Nsd1 A G 13: 55,213,918 Q233R probably benign Het
Olfr1141 T C 2: 87,753,783 D70G possibly damaging Het
Olfr738 T C 14: 50,413,915 F124L probably benign Het
Paqr5 T A 9: 61,956,156 I295L probably benign Het
Peg10 C T 6: 4,756,560 H379Y unknown Het
Phtf2 A T 5: 20,813,244 I33N probably damaging Het
Plcb2 T C 2: 118,723,496 M115V probably benign Het
Ppp2r3a A G 9: 101,126,377 Y431H possibly damaging Het
Prph2 GT G 17: 46,911,113 probably null Het
Psmd1 C T 1: 86,128,238 P774L probably damaging Het
Ranbp17 A T 11: 33,297,340 probably null Het
Rptn A G 3: 93,397,670 D770G possibly damaging Het
Serac1 A G 17: 6,050,812 L439P probably damaging Het
Slitrk6 TTTTAGTCTGTTCTACCAACACCTT TTT 14: 110,749,825 probably null Het
Sox6 T C 7: 115,597,509 I295M probably benign Het
Sulf1 T A 1: 12,859,413 D301E probably benign Het
Tbx2 C T 11: 85,834,735 R171C probably damaging Het
Tgfbr1 A G 4: 47,402,955 I320V probably benign Het
Tjp3 C A 10: 81,279,257 G396W probably damaging Het
Tmprss2 T C 16: 97,599,260 N4D possibly damaging Het
Tnfaip3 T C 10: 19,007,323 N165D probably benign Het
Tnfrsf21 A T 17: 43,037,911 Y138F probably benign Het
Utp4 T C 8: 106,906,185 S267P probably benign Het
Wnk1 A T 6: 119,963,367 L803* probably null Het
Zbbx T A 3: 75,136,487 D35V probably damaging Het
Zscan12 T G 13: 21,368,574 N189K possibly damaging Het
Other mutations in Tas2r117
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01611:Tas2r117 APN 6 132803484 missense probably benign 0.00
IGL01611:Tas2r117 APN 6 132803487 missense probably damaging 0.96
IGL02140:Tas2r117 APN 6 132803595 missense probably benign 0.15
IGL02154:Tas2r117 APN 6 132803715 missense probably benign 0.00
IGL02466:Tas2r117 APN 6 132803000 missense probably benign 0.12
IGL02942:Tas2r117 APN 6 132803694 missense probably benign 0.00
IGL03328:Tas2r117 APN 6 132803078 missense probably benign 0.40
R0380:Tas2r117 UTSW 6 132803588 nonsense probably null
R0456:Tas2r117 UTSW 6 132803391 missense probably benign 0.12
R0699:Tas2r117 UTSW 6 132803198 missense probably damaging 1.00
R2118:Tas2r117 UTSW 6 132803166 missense probably damaging 0.96
R2265:Tas2r117 UTSW 6 132803225 missense probably benign 0.06
R4420:Tas2r117 UTSW 6 132803349 nonsense probably null
R4861:Tas2r117 UTSW 6 132803129 missense probably benign 0.00
R4861:Tas2r117 UTSW 6 132803129 missense probably benign 0.00
R5233:Tas2r117 UTSW 6 132803622 missense possibly damaging 0.95
R5384:Tas2r117 UTSW 6 132803154 missense probably benign 0.04
R6750:Tas2r117 UTSW 6 132802854 start gained probably benign
R6852:Tas2r117 UTSW 6 132802929 missense probably benign 0.00
R6902:Tas2r117 UTSW 6 132803325 missense probably damaging 0.98
R6946:Tas2r117 UTSW 6 132803325 missense probably damaging 0.98
R7129:Tas2r117 UTSW 6 132803387 missense probably benign 0.01
R7412:Tas2r117 UTSW 6 132803229 missense probably damaging 1.00
R7733:Tas2r117 UTSW 6 132803175 missense probably benign 0.02
R7768:Tas2r117 UTSW 6 132803522 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCAGAAATTGTCGAAACAGC -3'
(R):5'- AGCAATCCAGATGCTGAAATGG -3'

Sequencing Primer
(F):5'- CATCTCAACTGGATATATGAGCAAG -3'
(R):5'- GCTGAAATGGTTGGCTAAAATCC -3'
Posted On2019-06-07