Incidental Mutation 'PIT4480001:Gipr'
ID554861
Institutional Source Beutler Lab
Gene Symbol Gipr
Ensembl Gene ENSMUSG00000030406
Gene Namegastric inhibitory polypeptide receptor
SynonymsLOC232937, glucose-dependent insulinotropic polypeptide receptor, LOC381853
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #PIT4480001 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location19156061-19166127 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19162934 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 137 (Y137C)
Ref Sequence ENSEMBL: ENSMUSP00000092384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094790] [ENSMUST00000206971]
Predicted Effect probably damaging
Transcript: ENSMUST00000094790
AA Change: Y137C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092384
Gene: ENSMUSG00000030406
AA Change: Y137C

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
HormR 53 123 6.14e-23 SMART
Pfam:7tm_2 130 384 1.3e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206971
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.7%
  • 10x: 83.8%
  • 20x: 69.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G-protein coupled receptor for gastric inhibitory polypeptide (GIP), which was originally identified as an activity in gut extracts that inhibited gastric acid secretion and gastrin release, but subsequently was demonstrated to stimulate insulin release in the presence of elevated glucose. Mice lacking this gene exhibit higher blood glucose levels with impaired initial insulin response after oral glucose load. Defect in this gene thus may contribute to the pathogenesis of diabetes. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous inactivation of this gene results in mild glucose intolerance due to impaired glucose-stimulated insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,283,752 M4475V probably benign Het
Actn3 G A 19: 4,867,577 Q413* probably null Het
Ahnak2 C T 12: 112,773,924 S1238N possibly damaging Het
Arsk T C 13: 76,062,365 E521G probably damaging Het
Baiap2 A G 11: 119,997,087 T356A probably benign Het
Baz1b G A 5: 135,217,965 R756H probably damaging Het
Celsr1 G A 15: 86,032,414 P453S probably damaging Het
Cep41 G A 6: 30,658,413 P196S probably damaging Het
Cln5 T A 14: 103,071,778 Y89* probably null Het
Cntnap3 A G 13: 64,757,210 F919S probably damaging Het
Cntrl C T 2: 35,155,428 H1383Y probably damaging Het
Cobl A G 11: 12,253,592 S1037P probably benign Het
Col17a1 A T 19: 47,671,374 S380T probably benign Het
Dagla A T 19: 10,260,658 S323T probably benign Het
Dicer1 G T 12: 104,696,544 Q1593K probably benign Het
Dnah6 T C 6: 73,101,880 I2367V probably benign Het
Emc1 T C 4: 139,359,277 S184P possibly damaging Het
Eps8l1 G A 7: 4,471,415 S295N probably benign Het
Erbb4 A T 1: 68,075,543 M914K probably damaging Het
Eva1a A G 6: 82,091,803 E37G probably damaging Het
Fam49b G A 15: 63,956,641 T11I probably benign Het
Fyco1 G T 9: 123,828,650 Y820* probably null Het
Gm5414 A G 15: 101,627,746 V148A probably damaging Het
Gpn1 T C 5: 31,497,341 V79A probably damaging Het
Grk2 G A 19: 4,287,409 R617C possibly damaging Het
Inpp4b A C 8: 82,046,267 E730A probably damaging Het
Inpp5f C T 7: 128,685,134 T579I probably benign Het
Kif15 A T 9: 123,011,543 M1201L probably benign Het
Ltbp3 A G 19: 5,751,226 N631S possibly damaging Het
Mdh1 G A 11: 21,558,538 S268L probably damaging Het
Mgat4e T A 1: 134,541,365 T314S possibly damaging Het
Nsd1 A G 13: 55,213,918 Q233R probably benign Het
Olfr1141 T C 2: 87,753,783 D70G possibly damaging Het
Olfr738 T C 14: 50,413,915 F124L probably benign Het
Paqr5 T A 9: 61,956,156 I295L probably benign Het
Peg10 C T 6: 4,756,560 H379Y unknown Het
Phtf2 A T 5: 20,813,244 I33N probably damaging Het
Plcb2 T C 2: 118,723,496 M115V probably benign Het
Ppp2r3a A G 9: 101,126,377 Y431H possibly damaging Het
Prph2 GT G 17: 46,911,113 probably null Het
Psmd1 C T 1: 86,128,238 P774L probably damaging Het
Ranbp17 A T 11: 33,297,340 probably null Het
Rptn A G 3: 93,397,670 D770G possibly damaging Het
Serac1 A G 17: 6,050,812 L439P probably damaging Het
Slitrk6 TTTTAGTCTGTTCTACCAACACCTT TTT 14: 110,749,825 probably null Het
Sox6 T C 7: 115,597,509 I295M probably benign Het
Sulf1 T A 1: 12,859,413 D301E probably benign Het
Tas2r117 G A 6: 132,803,051 V51I possibly damaging Het
Tbx2 C T 11: 85,834,735 R171C probably damaging Het
Tgfbr1 A G 4: 47,402,955 I320V probably benign Het
Tjp3 C A 10: 81,279,257 G396W probably damaging Het
Tmprss2 T C 16: 97,599,260 N4D possibly damaging Het
Tnfaip3 T C 10: 19,007,323 N165D probably benign Het
Tnfrsf21 A T 17: 43,037,911 Y138F probably benign Het
Utp4 T C 8: 106,906,185 S267P probably benign Het
Wnk1 A T 6: 119,963,367 L803* probably null Het
Zbbx T A 3: 75,136,487 D35V probably damaging Het
Zscan12 T G 13: 21,368,574 N189K possibly damaging Het
Other mutations in Gipr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Gipr APN 7 19159506 unclassified probably benign
IGL02214:Gipr APN 7 19157546 missense possibly damaging 0.46
IGL02525:Gipr APN 7 19159765 missense possibly damaging 0.64
IGL03163:Gipr APN 7 19162556 nonsense probably null
PIT4449001:Gipr UTSW 7 19160618 missense probably benign 0.05
R1813:Gipr UTSW 7 19164071 missense probably benign 0.02
R1896:Gipr UTSW 7 19164071 missense probably benign 0.02
R3409:Gipr UTSW 7 19159794 missense possibly damaging 0.74
R3949:Gipr UTSW 7 19157429 missense probably benign 0.00
R4781:Gipr UTSW 7 19157375 missense possibly damaging 0.95
R4841:Gipr UTSW 7 19162676 missense probably damaging 1.00
R4842:Gipr UTSW 7 19162676 missense probably damaging 1.00
R5087:Gipr UTSW 7 19159764 missense probably damaging 1.00
R5297:Gipr UTSW 7 19157544 missense probably damaging 1.00
R5480:Gipr UTSW 7 19160654 missense probably damaging 1.00
R5763:Gipr UTSW 7 19163550 missense probably damaging 0.99
R6957:Gipr UTSW 7 19164604 missense probably benign 0.01
R7035:Gipr UTSW 7 19162884 missense probably damaging 1.00
R7254:Gipr UTSW 7 19163613 missense probably damaging 1.00
R7720:Gipr UTSW 7 19162959 missense probably benign 0.02
Z1177:Gipr UTSW 7 19157565 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- AATTACGAGTGCAGTGCAGC -3'
(R):5'- CGCCTGTTTGGAGAGAAGGAAC -3'

Sequencing Primer
(F):5'- TGAAAAGCTGTCCTCAGGC -3'
(R):5'- CATTTTTCCCAGAAGAGACCGGG -3'
Posted On2019-06-07