Incidental Mutation 'PIT4480001:Sox6'
ID554862
Institutional Source Beutler Lab
Gene Symbol Sox6
Ensembl Gene ENSMUSG00000051910
Gene NameSRY (sex determining region Y)-box 6
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4480001 (G1)
Quality Score147.008
Status Not validated
Chromosome7
Chromosomal Location115470872-116038796 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115597509 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 295 (I295M)
Ref Sequence ENSEMBL: ENSMUSP00000072583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072804] [ENSMUST00000106612] [ENSMUST00000166207] [ENSMUST00000166877] [ENSMUST00000169129] [ENSMUST00000205405] [ENSMUST00000206034] [ENSMUST00000206369]
Predicted Effect probably benign
Transcript: ENSMUST00000072804
AA Change: I295M

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000072583
Gene: ENSMUSG00000051910
AA Change: I295M

DomainStartEndE-ValueType
coiled coil region 184 261 N/A INTRINSIC
low complexity region 462 484 N/A INTRINSIC
low complexity region 507 517 N/A INTRINSIC
HMG 619 689 1.5e-25 SMART
low complexity region 797 809 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106612
AA Change: I295M

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000102223
Gene: ENSMUSG00000051910
AA Change: I295M

DomainStartEndE-ValueType
coiled coil region 184 261 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
low complexity region 420 442 N/A INTRINSIC
low complexity region 465 475 N/A INTRINSIC
HMG 577 647 1.5e-25 SMART
low complexity region 755 767 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166207
AA Change: I295M

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000129027
Gene: ENSMUSG00000051910
AA Change: I295M

DomainStartEndE-ValueType
coiled coil region 184 261 N/A INTRINSIC
low complexity region 462 484 N/A INTRINSIC
low complexity region 507 517 N/A INTRINSIC
HMG 619 689 1.5e-25 SMART
low complexity region 797 809 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166877
AA Change: I296M

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000129512
Gene: ENSMUSG00000051910
AA Change: I296M

DomainStartEndE-ValueType
coiled coil region 184 263 N/A INTRINSIC
low complexity region 324 335 N/A INTRINSIC
low complexity region 422 444 N/A INTRINSIC
low complexity region 467 477 N/A INTRINSIC
HMG 579 649 1.5e-25 SMART
low complexity region 757 769 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169129
AA Change: I296M

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000126404
Gene: ENSMUSG00000051910
AA Change: I296M

DomainStartEndE-ValueType
coiled coil region 184 263 N/A INTRINSIC
low complexity region 324 335 N/A INTRINSIC
low complexity region 422 444 N/A INTRINSIC
low complexity region 467 477 N/A INTRINSIC
HMG 579 649 1.5e-25 SMART
low complexity region 757 769 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205405
AA Change: I296M

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000206034
AA Change: I296M

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000206369
AA Change: I296M

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.7%
  • 10x: 83.8%
  • 20x: 69.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a family of transcriptional regulators containing high mobility group (HMG) DNA-binding domains. Function of the encoded protein is important for proper cardiac and skeletal development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygotes for null mutations exhibit cardioskeletal myopathy, cardiac blockage, delayed growth, and early postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,283,752 M4475V probably benign Het
Actn3 G A 19: 4,867,577 Q413* probably null Het
Ahnak2 C T 12: 112,773,924 S1238N possibly damaging Het
Arsk T C 13: 76,062,365 E521G probably damaging Het
Baiap2 A G 11: 119,997,087 T356A probably benign Het
Baz1b G A 5: 135,217,965 R756H probably damaging Het
Celsr1 G A 15: 86,032,414 P453S probably damaging Het
Cep41 G A 6: 30,658,413 P196S probably damaging Het
Cln5 T A 14: 103,071,778 Y89* probably null Het
Cntnap3 A G 13: 64,757,210 F919S probably damaging Het
Cntrl C T 2: 35,155,428 H1383Y probably damaging Het
Cobl A G 11: 12,253,592 S1037P probably benign Het
Col17a1 A T 19: 47,671,374 S380T probably benign Het
Dagla A T 19: 10,260,658 S323T probably benign Het
Dicer1 G T 12: 104,696,544 Q1593K probably benign Het
Dnah6 T C 6: 73,101,880 I2367V probably benign Het
Emc1 T C 4: 139,359,277 S184P possibly damaging Het
Eps8l1 G A 7: 4,471,415 S295N probably benign Het
Erbb4 A T 1: 68,075,543 M914K probably damaging Het
Eva1a A G 6: 82,091,803 E37G probably damaging Het
Fam49b G A 15: 63,956,641 T11I probably benign Het
Fyco1 G T 9: 123,828,650 Y820* probably null Het
Gipr T C 7: 19,162,934 Y137C probably damaging Het
Gm5414 A G 15: 101,627,746 V148A probably damaging Het
Gpn1 T C 5: 31,497,341 V79A probably damaging Het
Grk2 G A 19: 4,287,409 R617C possibly damaging Het
Inpp4b A C 8: 82,046,267 E730A probably damaging Het
Inpp5f C T 7: 128,685,134 T579I probably benign Het
Kif15 A T 9: 123,011,543 M1201L probably benign Het
Ltbp3 A G 19: 5,751,226 N631S possibly damaging Het
Mdh1 G A 11: 21,558,538 S268L probably damaging Het
Mgat4e T A 1: 134,541,365 T314S possibly damaging Het
Nsd1 A G 13: 55,213,918 Q233R probably benign Het
Olfr1141 T C 2: 87,753,783 D70G possibly damaging Het
Olfr738 T C 14: 50,413,915 F124L probably benign Het
Paqr5 T A 9: 61,956,156 I295L probably benign Het
Peg10 C T 6: 4,756,560 H379Y unknown Het
Phtf2 A T 5: 20,813,244 I33N probably damaging Het
Plcb2 T C 2: 118,723,496 M115V probably benign Het
Ppp2r3a A G 9: 101,126,377 Y431H possibly damaging Het
Prph2 GT G 17: 46,911,113 probably null Het
Psmd1 C T 1: 86,128,238 P774L probably damaging Het
Ranbp17 A T 11: 33,297,340 probably null Het
Rptn A G 3: 93,397,670 D770G possibly damaging Het
Serac1 A G 17: 6,050,812 L439P probably damaging Het
Slitrk6 TTTTAGTCTGTTCTACCAACACCTT TTT 14: 110,749,825 probably null Het
Sulf1 T A 1: 12,859,413 D301E probably benign Het
Tas2r117 G A 6: 132,803,051 V51I possibly damaging Het
Tbx2 C T 11: 85,834,735 R171C probably damaging Het
Tgfbr1 A G 4: 47,402,955 I320V probably benign Het
Tjp3 C A 10: 81,279,257 G396W probably damaging Het
Tmprss2 T C 16: 97,599,260 N4D possibly damaging Het
Tnfaip3 T C 10: 19,007,323 N165D probably benign Het
Tnfrsf21 A T 17: 43,037,911 Y138F probably benign Het
Utp4 T C 8: 106,906,185 S267P probably benign Het
Wnk1 A T 6: 119,963,367 L803* probably null Het
Zbbx T A 3: 75,136,487 D35V probably damaging Het
Zscan12 T G 13: 21,368,574 N189K possibly damaging Het
Other mutations in Sox6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Sox6 APN 7 115477206 missense probably benign
IGL00957:Sox6 APN 7 115777092 missense probably damaging 1.00
IGL01624:Sox6 APN 7 115476968 missense probably damaging 1.00
IGL02057:Sox6 APN 7 115550075 missense probably damaging 1.00
IGL02385:Sox6 APN 7 115550039 missense possibly damaging 0.77
IGL02410:Sox6 APN 7 115486744 missense probably damaging 1.00
IGL02736:Sox6 APN 7 115580640 missense probably damaging 1.00
IGL02747:Sox6 APN 7 115489746 missense probably damaging 1.00
IGL02792:Sox6 APN 7 115541649 missense probably benign
R0458:Sox6 UTSW 7 115489794 missense probably damaging 1.00
R0689:Sox6 UTSW 7 115486551 missense probably damaging 1.00
R0800:Sox6 UTSW 7 115579014 critical splice donor site probably null
R1220:Sox6 UTSW 7 115662442 missense probably damaging 1.00
R1474:Sox6 UTSW 7 115701691 splice site probably benign
R1547:Sox6 UTSW 7 115701722 missense possibly damaging 0.93
R1570:Sox6 UTSW 7 115777123 missense probably damaging 1.00
R1674:Sox6 UTSW 7 115801419 missense probably benign 0.00
R1704:Sox6 UTSW 7 115476948 missense possibly damaging 0.92
R1754:Sox6 UTSW 7 115477055 missense probably benign
R1833:Sox6 UTSW 7 115777093 missense probably damaging 1.00
R1868:Sox6 UTSW 7 115659538 missense possibly damaging 0.89
R1893:Sox6 UTSW 7 115544568 missense probably benign 0.28
R2386:Sox6 UTSW 7 115597505 missense probably damaging 1.00
R2431:Sox6 UTSW 7 115550007 splice site probably null
R4303:Sox6 UTSW 7 115544469 critical splice donor site probably null
R4319:Sox6 UTSW 7 115580563 critical splice donor site probably null
R4320:Sox6 UTSW 7 115580563 critical splice donor site probably null
R4321:Sox6 UTSW 7 115580563 critical splice donor site probably null
R4323:Sox6 UTSW 7 115580563 critical splice donor site probably null
R4335:Sox6 UTSW 7 115512724 missense probably benign
R4567:Sox6 UTSW 7 115662322 missense probably benign 0.26
R4776:Sox6 UTSW 7 115541670 missense probably damaging 1.00
R4838:Sox6 UTSW 7 115486662 missense probably damaging 1.00
R4914:Sox6 UTSW 7 115476964 missense probably damaging 1.00
R4915:Sox6 UTSW 7 115476964 missense probably damaging 1.00
R5184:Sox6 UTSW 7 115777228 missense probably damaging 1.00
R5372:Sox6 UTSW 7 115550151 nonsense probably null
R5454:Sox6 UTSW 7 115701773 missense possibly damaging 0.89
R5663:Sox6 UTSW 7 115550054 missense probably benign
R5685:Sox6 UTSW 7 115579157 intron probably null
R5734:Sox6 UTSW 7 115541621 critical splice donor site probably null
R6020:Sox6 UTSW 7 115486628 missense probably damaging 1.00
R6211:Sox6 UTSW 7 115801462 missense probably damaging 1.00
R6263:Sox6 UTSW 7 115477060 missense probably damaging 1.00
R6549:Sox6 UTSW 7 115486692 missense possibly damaging 0.79
R6576:Sox6 UTSW 7 115701702 missense probably damaging 0.96
R6680:Sox6 UTSW 7 115476983 missense possibly damaging 0.94
R6709:Sox6 UTSW 7 115701789 splice site probably null
R6747:Sox6 UTSW 7 115541731 missense probably damaging 1.00
R6755:Sox6 UTSW 7 115662442 missense probably damaging 0.99
R7233:Sox6 UTSW 7 115489809 missense possibly damaging 0.80
R7423:Sox6 UTSW 7 115550023 missense probably benign 0.30
R7455:Sox6 UTSW 7 115489669 missense probably benign 0.02
R7522:Sox6 UTSW 7 115801578 missense probably damaging 1.00
R7527:Sox6 UTSW 7 115777173 missense probably benign 0.00
R7852:Sox6 UTSW 7 115801604 start codon destroyed probably null 1.00
R8278:Sox6 UTSW 7 115476964 missense probably damaging 1.00
X0061:Sox6 UTSW 7 115477148 missense probably benign 0.00
X0065:Sox6 UTSW 7 115550108 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCGATTAGTTATGACAATGCCCC -3'
(R):5'- CAGCTCTGCAAAGAGGTTTG -3'

Sequencing Primer
(F):5'- CTGTGTTTGTTGTGACTACTAA -3'
(R):5'- AGCAGCTCCAGCAATGG -3'
Posted On2019-06-07