Incidental Mutation 'PIT4480001:Paqr5'
ID554866
Institutional Source Beutler Lab
Gene Symbol Paqr5
Ensembl Gene ENSMUSG00000032278
Gene Nameprogestin and adipoQ receptor family member V
Synonyms0610010I15Rik, mPRg
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #PIT4480001 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location61953481-62026856 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 61956156 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 295 (I295L)
Ref Sequence ENSEMBL: ENSMUSP00000034817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034817] [ENSMUST00000113990]
Predicted Effect probably benign
Transcript: ENSMUST00000034817
AA Change: I295L

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000034817
Gene: ENSMUSG00000032278
AA Change: I295L

DomainStartEndE-ValueType
Pfam:HlyIII 43 269 1.6e-59 PFAM
transmembrane domain 295 317 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113990
AA Change: I281L

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000109623
Gene: ENSMUSG00000032278
AA Change: I281L

DomainStartEndE-ValueType
Pfam:HlyIII 29 255 6.4e-51 PFAM
transmembrane domain 281 303 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.7%
  • 10x: 83.8%
  • 20x: 69.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,283,752 M4475V probably benign Het
Actn3 G A 19: 4,867,577 Q413* probably null Het
Ahnak2 C T 12: 112,773,924 S1238N possibly damaging Het
Arsk T C 13: 76,062,365 E521G probably damaging Het
Baiap2 A G 11: 119,997,087 T356A probably benign Het
Baz1b G A 5: 135,217,965 R756H probably damaging Het
Celsr1 G A 15: 86,032,414 P453S probably damaging Het
Cep41 G A 6: 30,658,413 P196S probably damaging Het
Cln5 T A 14: 103,071,778 Y89* probably null Het
Cntnap3 A G 13: 64,757,210 F919S probably damaging Het
Cntrl C T 2: 35,155,428 H1383Y probably damaging Het
Cobl A G 11: 12,253,592 S1037P probably benign Het
Col17a1 A T 19: 47,671,374 S380T probably benign Het
Dagla A T 19: 10,260,658 S323T probably benign Het
Dicer1 G T 12: 104,696,544 Q1593K probably benign Het
Dnah6 T C 6: 73,101,880 I2367V probably benign Het
Emc1 T C 4: 139,359,277 S184P possibly damaging Het
Eps8l1 G A 7: 4,471,415 S295N probably benign Het
Erbb4 A T 1: 68,075,543 M914K probably damaging Het
Eva1a A G 6: 82,091,803 E37G probably damaging Het
Fam49b G A 15: 63,956,641 T11I probably benign Het
Fyco1 G T 9: 123,828,650 Y820* probably null Het
Gipr T C 7: 19,162,934 Y137C probably damaging Het
Gm5414 A G 15: 101,627,746 V148A probably damaging Het
Gpn1 T C 5: 31,497,341 V79A probably damaging Het
Grk2 G A 19: 4,287,409 R617C possibly damaging Het
Inpp4b A C 8: 82,046,267 E730A probably damaging Het
Inpp5f C T 7: 128,685,134 T579I probably benign Het
Kif15 A T 9: 123,011,543 M1201L probably benign Het
Ltbp3 A G 19: 5,751,226 N631S possibly damaging Het
Mdh1 G A 11: 21,558,538 S268L probably damaging Het
Mgat4e T A 1: 134,541,365 T314S possibly damaging Het
Nsd1 A G 13: 55,213,918 Q233R probably benign Het
Olfr1141 T C 2: 87,753,783 D70G possibly damaging Het
Olfr738 T C 14: 50,413,915 F124L probably benign Het
Peg10 C T 6: 4,756,560 H379Y unknown Het
Phtf2 A T 5: 20,813,244 I33N probably damaging Het
Plcb2 T C 2: 118,723,496 M115V probably benign Het
Ppp2r3a A G 9: 101,126,377 Y431H possibly damaging Het
Prph2 GT G 17: 46,911,113 probably null Het
Psmd1 C T 1: 86,128,238 P774L probably damaging Het
Ranbp17 A T 11: 33,297,340 probably null Het
Rptn A G 3: 93,397,670 D770G possibly damaging Het
Serac1 A G 17: 6,050,812 L439P probably damaging Het
Slitrk6 TTTTAGTCTGTTCTACCAACACCTT TTT 14: 110,749,825 probably null Het
Sox6 T C 7: 115,597,509 I295M probably benign Het
Sulf1 T A 1: 12,859,413 D301E probably benign Het
Tas2r117 G A 6: 132,803,051 V51I possibly damaging Het
Tbx2 C T 11: 85,834,735 R171C probably damaging Het
Tgfbr1 A G 4: 47,402,955 I320V probably benign Het
Tjp3 C A 10: 81,279,257 G396W probably damaging Het
Tmprss2 T C 16: 97,599,260 N4D possibly damaging Het
Tnfaip3 T C 10: 19,007,323 N165D probably benign Het
Tnfrsf21 A T 17: 43,037,911 Y138F probably benign Het
Utp4 T C 8: 106,906,185 S267P probably benign Het
Wnk1 A T 6: 119,963,367 L803* probably null Het
Zbbx T A 3: 75,136,487 D35V probably damaging Het
Zscan12 T G 13: 21,368,574 N189K possibly damaging Het
Other mutations in Paqr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02893:Paqr5 APN 9 61968868 missense probably benign 0.00
IGL03190:Paqr5 APN 9 61972802 missense probably damaging 0.97
R0528:Paqr5 UTSW 9 61956245 missense probably damaging 1.00
R0686:Paqr5 UTSW 9 61972794 missense probably benign 0.00
R0688:Paqr5 UTSW 9 61972794 missense probably benign 0.00
R1323:Paqr5 UTSW 9 61961528 critical splice donor site probably null
R1323:Paqr5 UTSW 9 61961528 critical splice donor site probably null
R2872:Paqr5 UTSW 9 61968779 critical splice donor site probably null
R2872:Paqr5 UTSW 9 61968779 critical splice donor site probably null
R5663:Paqr5 UTSW 9 61968862 missense probably benign 0.03
R6726:Paqr5 UTSW 9 61963783 missense probably damaging 1.00
R6728:Paqr5 UTSW 9 61963783 missense probably damaging 1.00
R6795:Paqr5 UTSW 9 61963783 missense probably damaging 1.00
R6796:Paqr5 UTSW 9 61963783 missense probably damaging 1.00
R6809:Paqr5 UTSW 9 61968782 missense probably null 1.00
R6857:Paqr5 UTSW 9 61976088 missense probably damaging 1.00
R6967:Paqr5 UTSW 9 61972831 nonsense probably null
R7456:Paqr5 UTSW 9 61972790 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- AAGACATCAGTTGCTACGAATGC -3'
(R):5'- GGAGTCTTCACCCACTAAGC -3'

Sequencing Primer
(F):5'- ACGAATGCTTTTGGCCACTGTAAG -3'
(R):5'- ACCCACTAAGCTGTTTCTCTGG -3'
Posted On2019-06-07