Incidental Mutation 'PIT4480001:Ppp2r3a'
ID554867
Institutional Source Beutler Lab
Gene Symbol Ppp2r3a
Ensembl Gene ENSMUSG00000043154
Gene Nameprotein phosphatase 2, regulatory subunit B'', alpha
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4480001 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location101105084-101251795 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101126377 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 431 (Y431H)
Ref Sequence ENSEMBL: ENSMUSP00000069688 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066773] [ENSMUST00000075941]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066773
AA Change: Y431H

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000069688
Gene: ENSMUSG00000043154
AA Change: Y431H

DomainStartEndE-ValueType
Blast:EFh 140 169 1e-9 BLAST
Pfam:EF-hand_7 282 380 2.6e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000075941
AA Change: Y1051H

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000075327
Gene: ENSMUSG00000043154
AA Change: Y1051H

DomainStartEndE-ValueType
low complexity region 248 266 N/A INTRINSIC
Blast:EFh 760 789 1e-9 BLAST
Pfam:EF-hand_7 902 1000 2.5e-17 PFAM
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.7%
  • 10x: 83.8%
  • 20x: 69.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the regulatory subunits of the protein phosphatase 2. Protein phosphatase 2 (formerly named type 2A) is one of the four major Ser/Thr phosphatases and is implicated in the negative control of cell growth and division. Protein phosphatase 2 holoenzymes are heterotrimeric proteins composed of a structural subunit A, a catalytic subunit C, and a regulatory subunit B. The regulatory subunit is encoded by a diverse set of genes that have been grouped into the B/PR55, B'/PR61, and B''/PR72 families. These different regulatory subunits confer distinct enzymatic specificities and intracellular localizations to the holozenzyme. The product of this gene belongs to the B'' family. The B'' family has been further divided into subfamilies. The product of this gene belongs to the alpha subfamily of regulatory subunit B''. Alternative splicing results in multiple transcript variants encoding different isoforms.[provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,283,752 M4475V probably benign Het
Actn3 G A 19: 4,867,577 Q413* probably null Het
Ahnak2 C T 12: 112,773,924 S1238N possibly damaging Het
Arsk T C 13: 76,062,365 E521G probably damaging Het
Baiap2 A G 11: 119,997,087 T356A probably benign Het
Baz1b G A 5: 135,217,965 R756H probably damaging Het
Celsr1 G A 15: 86,032,414 P453S probably damaging Het
Cep41 G A 6: 30,658,413 P196S probably damaging Het
Cln5 T A 14: 103,071,778 Y89* probably null Het
Cntnap3 A G 13: 64,757,210 F919S probably damaging Het
Cntrl C T 2: 35,155,428 H1383Y probably damaging Het
Cobl A G 11: 12,253,592 S1037P probably benign Het
Col17a1 A T 19: 47,671,374 S380T probably benign Het
Dagla A T 19: 10,260,658 S323T probably benign Het
Dicer1 G T 12: 104,696,544 Q1593K probably benign Het
Dnah6 T C 6: 73,101,880 I2367V probably benign Het
Emc1 T C 4: 139,359,277 S184P possibly damaging Het
Eps8l1 G A 7: 4,471,415 S295N probably benign Het
Erbb4 A T 1: 68,075,543 M914K probably damaging Het
Eva1a A G 6: 82,091,803 E37G probably damaging Het
Fam49b G A 15: 63,956,641 T11I probably benign Het
Fyco1 G T 9: 123,828,650 Y820* probably null Het
Gipr T C 7: 19,162,934 Y137C probably damaging Het
Gm5414 A G 15: 101,627,746 V148A probably damaging Het
Gpn1 T C 5: 31,497,341 V79A probably damaging Het
Grk2 G A 19: 4,287,409 R617C possibly damaging Het
Inpp4b A C 8: 82,046,267 E730A probably damaging Het
Inpp5f C T 7: 128,685,134 T579I probably benign Het
Kif15 A T 9: 123,011,543 M1201L probably benign Het
Ltbp3 A G 19: 5,751,226 N631S possibly damaging Het
Mdh1 G A 11: 21,558,538 S268L probably damaging Het
Mgat4e T A 1: 134,541,365 T314S possibly damaging Het
Nsd1 A G 13: 55,213,918 Q233R probably benign Het
Olfr1141 T C 2: 87,753,783 D70G possibly damaging Het
Olfr738 T C 14: 50,413,915 F124L probably benign Het
Paqr5 T A 9: 61,956,156 I295L probably benign Het
Peg10 C T 6: 4,756,560 H379Y unknown Het
Phtf2 A T 5: 20,813,244 I33N probably damaging Het
Plcb2 T C 2: 118,723,496 M115V probably benign Het
Prph2 GT G 17: 46,911,113 probably null Het
Psmd1 C T 1: 86,128,238 P774L probably damaging Het
Ranbp17 A T 11: 33,297,340 probably null Het
Rptn A G 3: 93,397,670 D770G possibly damaging Het
Serac1 A G 17: 6,050,812 L439P probably damaging Het
Slitrk6 TTTTAGTCTGTTCTACCAACACCTT TTT 14: 110,749,825 probably null Het
Sox6 T C 7: 115,597,509 I295M probably benign Het
Sulf1 T A 1: 12,859,413 D301E probably benign Het
Tas2r117 G A 6: 132,803,051 V51I possibly damaging Het
Tbx2 C T 11: 85,834,735 R171C probably damaging Het
Tgfbr1 A G 4: 47,402,955 I320V probably benign Het
Tjp3 C A 10: 81,279,257 G396W probably damaging Het
Tmprss2 T C 16: 97,599,260 N4D possibly damaging Het
Tnfaip3 T C 10: 19,007,323 N165D probably benign Het
Tnfrsf21 A T 17: 43,037,911 Y138F probably benign Het
Utp4 T C 8: 106,906,185 S267P probably benign Het
Wnk1 A T 6: 119,963,367 L803* probably null Het
Zbbx T A 3: 75,136,487 D35V probably damaging Het
Zscan12 T G 13: 21,368,574 N189K possibly damaging Het
Other mutations in Ppp2r3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00792:Ppp2r3a APN 9 101211301 missense possibly damaging 0.50
IGL01122:Ppp2r3a APN 9 101211645 missense probably benign 0.30
IGL02332:Ppp2r3a APN 9 101180403 missense possibly damaging 0.78
IGL02653:Ppp2r3a APN 9 101211693 missense probably benign 0.13
IGL03329:Ppp2r3a APN 9 101126431 splice site probably benign
IGL03351:Ppp2r3a APN 9 101211192 missense probably benign 0.00
lank UTSW 9 101198630 critical splice donor site probably null
PIT4687001:Ppp2r3a UTSW 9 101144380 missense probably benign 0.00
R0243:Ppp2r3a UTSW 9 101212284 missense probably damaging 1.00
R1004:Ppp2r3a UTSW 9 101198630 critical splice donor site probably null
R1086:Ppp2r3a UTSW 9 101153822 missense possibly damaging 0.67
R1215:Ppp2r3a UTSW 9 101212684 missense probably benign 0.02
R1245:Ppp2r3a UTSW 9 101194394 missense probably damaging 0.99
R1458:Ppp2r3a UTSW 9 101211312 missense probably damaging 1.00
R1682:Ppp2r3a UTSW 9 101212306 missense probably benign 0.00
R1857:Ppp2r3a UTSW 9 101212893 missense probably damaging 0.96
R1972:Ppp2r3a UTSW 9 101211777 missense probably benign 0.00
R2029:Ppp2r3a UTSW 9 101145481 missense probably damaging 1.00
R2076:Ppp2r3a UTSW 9 101144371 missense possibly damaging 0.83
R2135:Ppp2r3a UTSW 9 101211558 missense probably damaging 0.99
R2180:Ppp2r3a UTSW 9 101127015 nonsense probably null
R3155:Ppp2r3a UTSW 9 101212360 missense possibly damaging 0.56
R4797:Ppp2r3a UTSW 9 101211980 missense probably benign 0.01
R4829:Ppp2r3a UTSW 9 101212510 missense possibly damaging 0.67
R5269:Ppp2r3a UTSW 9 101153865 missense probably damaging 0.98
R5917:Ppp2r3a UTSW 9 101211984 missense probably benign 0.10
R5939:Ppp2r3a UTSW 9 101212625 missense probably benign 0.37
R6089:Ppp2r3a UTSW 9 101211636 missense probably benign 0.00
R6254:Ppp2r3a UTSW 9 101148587 missense possibly damaging 0.75
R6574:Ppp2r3a UTSW 9 101194385 missense probably benign 0.03
R6776:Ppp2r3a UTSW 9 101212862 missense probably benign 0.00
R6927:Ppp2r3a UTSW 9 101175348 missense probably damaging 1.00
R7189:Ppp2r3a UTSW 9 101126422 missense possibly damaging 0.59
R7190:Ppp2r3a UTSW 9 101212527 missense probably benign 0.11
R7288:Ppp2r3a UTSW 9 101127004 missense probably damaging 0.98
R7292:Ppp2r3a UTSW 9 101212672 missense probably damaging 0.96
R7512:Ppp2r3a UTSW 9 101175333 missense possibly damaging 0.69
R7655:Ppp2r3a UTSW 9 101211712 missense probably benign 0.30
R7656:Ppp2r3a UTSW 9 101211712 missense probably benign 0.30
X0020:Ppp2r3a UTSW 9 101212039 missense probably benign 0.19
Z1176:Ppp2r3a UTSW 9 101126389 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TGGGATCAGGTATTTTAGACACTG -3'
(R):5'- AAACTACAGTTCTTTGCTGGGTG -3'

Sequencing Primer
(F):5'- ACACTGTCTCTTTAAATACAGAAAGC -3'
(R):5'- CATGAATGTACTTAAAGCCACTGG -3'
Posted On2019-06-07