Incidental Mutation 'PIT4480001:Fyco1'
ID554869
Institutional Source Beutler Lab
Gene Symbol Fyco1
Ensembl Gene ENSMUSG00000025241
Gene NameFYVE and coiled-coil domain containing 1
SynonymsMem2, ZFYVE7, 2810409M01Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4480001 (G1)
Quality Score121.008
Status Not validated
Chromosome9
Chromosomal Location123789500-123851899 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 123828650 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 820 (Y820*)
Ref Sequence ENSEMBL: ENSMUSP00000081764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084715] [ENSMUST00000167595] [ENSMUST00000184082]
Predicted Effect probably null
Transcript: ENSMUST00000084715
AA Change: Y820*
SMART Domains Protein: ENSMUSP00000081764
Gene: ENSMUSG00000025241
AA Change: Y820*

DomainStartEndE-ValueType
Pfam:RUN 19 167 4.7e-12 PFAM
low complexity region 196 206 N/A INTRINSIC
coiled coil region 223 270 N/A INTRINSIC
coiled coil region 348 1110 N/A INTRINSIC
FYVE 1124 1191 2.69e-16 SMART
PDB:1OLM|E 1343 1428 1e-5 PDB
Predicted Effect probably null
Transcript: ENSMUST00000167595
AA Change: Y820*
SMART Domains Protein: ENSMUSP00000133222
Gene: ENSMUSG00000025241
AA Change: Y820*

DomainStartEndE-ValueType
Pfam:RUN 20 167 7.8e-12 PFAM
low complexity region 196 206 N/A INTRINSIC
coiled coil region 223 270 N/A INTRINSIC
coiled coil region 348 1110 N/A INTRINSIC
FYVE 1124 1191 2.69e-16 SMART
PDB:1OLM|E 1343 1428 1e-5 PDB
Predicted Effect probably null
Transcript: ENSMUST00000184082
AA Change: Y820*
SMART Domains Protein: ENSMUSP00000139343
Gene: ENSMUSG00000025241
AA Change: Y820*

DomainStartEndE-ValueType
Pfam:RUN 7 167 4.5e-12 PFAM
low complexity region 196 206 N/A INTRINSIC
coiled coil region 223 270 N/A INTRINSIC
low complexity region 355 366 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.7%
  • 10x: 83.8%
  • 20x: 69.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a RUN domain, FYVE-type zinc finger domain and Golgi dynamics (GOLD) domain. The encoded protein plays a role in microtubule plus end-directed transport of autophagic vesicles through interactions with the small GTPase Rab7, phosphatidylinositol-3-phosphate (PI3P) and the autophagosome marker LC3. Mutations in this gene are a cause of autosomal recessive congenital cataract-2 (CATC2). [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,283,752 M4475V probably benign Het
Actn3 G A 19: 4,867,577 Q413* probably null Het
Ahnak2 C T 12: 112,773,924 S1238N possibly damaging Het
Arsk T C 13: 76,062,365 E521G probably damaging Het
Baiap2 A G 11: 119,997,087 T356A probably benign Het
Baz1b G A 5: 135,217,965 R756H probably damaging Het
Celsr1 G A 15: 86,032,414 P453S probably damaging Het
Cep41 G A 6: 30,658,413 P196S probably damaging Het
Cln5 T A 14: 103,071,778 Y89* probably null Het
Cntnap3 A G 13: 64,757,210 F919S probably damaging Het
Cntrl C T 2: 35,155,428 H1383Y probably damaging Het
Cobl A G 11: 12,253,592 S1037P probably benign Het
Col17a1 A T 19: 47,671,374 S380T probably benign Het
Dagla A T 19: 10,260,658 S323T probably benign Het
Dicer1 G T 12: 104,696,544 Q1593K probably benign Het
Dnah6 T C 6: 73,101,880 I2367V probably benign Het
Emc1 T C 4: 139,359,277 S184P possibly damaging Het
Eps8l1 G A 7: 4,471,415 S295N probably benign Het
Erbb4 A T 1: 68,075,543 M914K probably damaging Het
Eva1a A G 6: 82,091,803 E37G probably damaging Het
Fam49b G A 15: 63,956,641 T11I probably benign Het
Gipr T C 7: 19,162,934 Y137C probably damaging Het
Gm5414 A G 15: 101,627,746 V148A probably damaging Het
Gpn1 T C 5: 31,497,341 V79A probably damaging Het
Grk2 G A 19: 4,287,409 R617C possibly damaging Het
Inpp4b A C 8: 82,046,267 E730A probably damaging Het
Inpp5f C T 7: 128,685,134 T579I probably benign Het
Kif15 A T 9: 123,011,543 M1201L probably benign Het
Ltbp3 A G 19: 5,751,226 N631S possibly damaging Het
Mdh1 G A 11: 21,558,538 S268L probably damaging Het
Mgat4e T A 1: 134,541,365 T314S possibly damaging Het
Nsd1 A G 13: 55,213,918 Q233R probably benign Het
Olfr1141 T C 2: 87,753,783 D70G possibly damaging Het
Olfr738 T C 14: 50,413,915 F124L probably benign Het
Paqr5 T A 9: 61,956,156 I295L probably benign Het
Peg10 C T 6: 4,756,560 H379Y unknown Het
Phtf2 A T 5: 20,813,244 I33N probably damaging Het
Plcb2 T C 2: 118,723,496 M115V probably benign Het
Ppp2r3a A G 9: 101,126,377 Y431H possibly damaging Het
Prph2 GT G 17: 46,911,113 probably null Het
Psmd1 C T 1: 86,128,238 P774L probably damaging Het
Ranbp17 A T 11: 33,297,340 probably null Het
Rptn A G 3: 93,397,670 D770G possibly damaging Het
Serac1 A G 17: 6,050,812 L439P probably damaging Het
Slitrk6 TTTTAGTCTGTTCTACCAACACCTT TTT 14: 110,749,825 probably null Het
Sox6 T C 7: 115,597,509 I295M probably benign Het
Sulf1 T A 1: 12,859,413 D301E probably benign Het
Tas2r117 G A 6: 132,803,051 V51I possibly damaging Het
Tbx2 C T 11: 85,834,735 R171C probably damaging Het
Tgfbr1 A G 4: 47,402,955 I320V probably benign Het
Tjp3 C A 10: 81,279,257 G396W probably damaging Het
Tmprss2 T C 16: 97,599,260 N4D possibly damaging Het
Tnfaip3 T C 10: 19,007,323 N165D probably benign Het
Tnfrsf21 A T 17: 43,037,911 Y138F probably benign Het
Utp4 T C 8: 106,906,185 S267P probably benign Het
Wnk1 A T 6: 119,963,367 L803* probably null Het
Zbbx T A 3: 75,136,487 D35V probably damaging Het
Zscan12 T G 13: 21,368,574 N189K possibly damaging Het
Other mutations in Fyco1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Fyco1 APN 9 123838897 missense probably damaging 1.00
IGL01407:Fyco1 APN 9 123828879 missense probably damaging 1.00
IGL01621:Fyco1 APN 9 123827182 unclassified probably benign
IGL01908:Fyco1 APN 9 123829230 missense probably damaging 1.00
IGL02006:Fyco1 APN 9 123829831 nonsense probably null
IGL02899:Fyco1 APN 9 123830331 missense possibly damaging 0.47
IGL03166:Fyco1 APN 9 123828387 missense probably benign 0.00
IGL03272:Fyco1 APN 9 123829603 missense probably benign 0.00
BB009:Fyco1 UTSW 9 123828990 missense not run
BB019:Fyco1 UTSW 9 123828990 missense not run
R0013:Fyco1 UTSW 9 123822406 missense probably benign
R0025:Fyco1 UTSW 9 123829009 missense probably damaging 1.00
R0349:Fyco1 UTSW 9 123797662 missense probably damaging 0.98
R0751:Fyco1 UTSW 9 123819153 missense probably damaging 1.00
R1184:Fyco1 UTSW 9 123819153 missense probably damaging 1.00
R1563:Fyco1 UTSW 9 123827182 unclassified probably benign
R1618:Fyco1 UTSW 9 123829281 missense probably damaging 1.00
R1732:Fyco1 UTSW 9 123819092 missense probably benign 0.32
R1873:Fyco1 UTSW 9 123823238 missense probably benign
R1920:Fyco1 UTSW 9 123830413 missense probably damaging 1.00
R2108:Fyco1 UTSW 9 123797516 critical splice donor site probably null
R2849:Fyco1 UTSW 9 123834826 nonsense probably null
R2944:Fyco1 UTSW 9 123826648 missense probably benign 0.02
R4035:Fyco1 UTSW 9 123801283 missense probably benign 0.00
R4120:Fyco1 UTSW 9 123825626 missense probably benign 0.00
R4198:Fyco1 UTSW 9 123826634 missense probably benign
R4534:Fyco1 UTSW 9 123838888 missense probably damaging 1.00
R4535:Fyco1 UTSW 9 123838888 missense probably damaging 1.00
R4536:Fyco1 UTSW 9 123838888 missense probably damaging 1.00
R5408:Fyco1 UTSW 9 123829503 missense probably damaging 0.99
R5522:Fyco1 UTSW 9 123794771 nonsense probably null
R5755:Fyco1 UTSW 9 123828708 missense possibly damaging 0.71
R5781:Fyco1 UTSW 9 123794833 missense probably damaging 1.00
R5813:Fyco1 UTSW 9 123831348 missense probably damaging 1.00
R7090:Fyco1 UTSW 9 123797719 missense probably damaging 0.98
R7205:Fyco1 UTSW 9 123822426 missense probably benign 0.00
R8086:Fyco1 UTSW 9 123830406 missense probably damaging 1.00
R8103:Fyco1 UTSW 9 123829388 missense probably benign 0.17
Z1177:Fyco1 UTSW 9 123828323 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGATCCTTCTCAGCTGTCAG -3'
(R):5'- TTACAGAATGAGGTGGTGGACC -3'

Sequencing Primer
(F):5'- TGTCAGTGCACAGACCTGTATAC -3'
(R):5'- TGGCCCTAGGTGATCGAGAC -3'
Posted On2019-06-07