Incidental Mutation 'PIT4480001:Tjp3'
ID554871
Institutional Source Beutler Lab
Gene Symbol Tjp3
Ensembl Gene ENSMUSG00000034917
Gene Nametight junction protein 3
SynonymsZO-3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4480001 (G1)
Quality Score91.0077
Status Not validated
Chromosome10
Chromosomal Location81273207-81291581 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 81279257 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 396 (G396W)
Ref Sequence ENSEMBL: ENSMUSP00000036438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045744] [ENSMUST00000218484] [ENSMUST00000219479]
Predicted Effect probably damaging
Transcript: ENSMUST00000045744
AA Change: G396W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036438
Gene: ENSMUSG00000034917
AA Change: G396W

DomainStartEndE-ValueType
PDZ 20 93 2.81e-18 SMART
low complexity region 119 162 N/A INTRINSIC
PDZ 196 264 2.71e-11 SMART
low complexity region 297 305 N/A INTRINSIC
PDZ 378 451 4.97e-19 SMART
SH3 466 539 9.96e-2 SMART
low complexity region 548 559 N/A INTRINSIC
GuKc 570 756 6.9e-46 SMART
Blast:GuKc 767 898 9e-27 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000218484
Predicted Effect probably damaging
Transcript: ENSMUST00000219479
AA Change: G396W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.7%
  • 10x: 83.8%
  • 20x: 69.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the membrane-associated guanylate kinase-like (MAGUK) protein family which is characterized by members having multiple PDZ domains, a single SH3 domain, and a single guanylate kinase-like (GUK)-domain. In addition, members of the zonula occludens protein subfamily have an acidic domain, a basic arginine-rich region, and a proline-rich domain. The protein encoded by this gene plays a role in the linkage between the actin cytoskeleton and tight-junctions and also sequesters cyclin D1 at tight junctions during mitosis. Alternative splicing results in multiple transcript variants encoding distinct isoforms. This gene has a partial pseudogene on chromosome 1. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygous mutation of this gene results in viable and fertile mice with no abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,283,752 M4475V probably benign Het
Actn3 G A 19: 4,867,577 Q413* probably null Het
Ahnak2 C T 12: 112,773,924 S1238N possibly damaging Het
Arsk T C 13: 76,062,365 E521G probably damaging Het
Baiap2 A G 11: 119,997,087 T356A probably benign Het
Baz1b G A 5: 135,217,965 R756H probably damaging Het
Celsr1 G A 15: 86,032,414 P453S probably damaging Het
Cep41 G A 6: 30,658,413 P196S probably damaging Het
Cln5 T A 14: 103,071,778 Y89* probably null Het
Cntnap3 A G 13: 64,757,210 F919S probably damaging Het
Cntrl C T 2: 35,155,428 H1383Y probably damaging Het
Cobl A G 11: 12,253,592 S1037P probably benign Het
Col17a1 A T 19: 47,671,374 S380T probably benign Het
Dagla A T 19: 10,260,658 S323T probably benign Het
Dicer1 G T 12: 104,696,544 Q1593K probably benign Het
Dnah6 T C 6: 73,101,880 I2367V probably benign Het
Emc1 T C 4: 139,359,277 S184P possibly damaging Het
Eps8l1 G A 7: 4,471,415 S295N probably benign Het
Erbb4 A T 1: 68,075,543 M914K probably damaging Het
Eva1a A G 6: 82,091,803 E37G probably damaging Het
Fam49b G A 15: 63,956,641 T11I probably benign Het
Fyco1 G T 9: 123,828,650 Y820* probably null Het
Gipr T C 7: 19,162,934 Y137C probably damaging Het
Gm5414 A G 15: 101,627,746 V148A probably damaging Het
Gpn1 T C 5: 31,497,341 V79A probably damaging Het
Grk2 G A 19: 4,287,409 R617C possibly damaging Het
Inpp4b A C 8: 82,046,267 E730A probably damaging Het
Inpp5f C T 7: 128,685,134 T579I probably benign Het
Kif15 A T 9: 123,011,543 M1201L probably benign Het
Ltbp3 A G 19: 5,751,226 N631S possibly damaging Het
Mdh1 G A 11: 21,558,538 S268L probably damaging Het
Mgat4e T A 1: 134,541,365 T314S possibly damaging Het
Nsd1 A G 13: 55,213,918 Q233R probably benign Het
Olfr1141 T C 2: 87,753,783 D70G possibly damaging Het
Olfr738 T C 14: 50,413,915 F124L probably benign Het
Paqr5 T A 9: 61,956,156 I295L probably benign Het
Peg10 C T 6: 4,756,560 H379Y unknown Het
Phtf2 A T 5: 20,813,244 I33N probably damaging Het
Plcb2 T C 2: 118,723,496 M115V probably benign Het
Ppp2r3a A G 9: 101,126,377 Y431H possibly damaging Het
Prph2 GT G 17: 46,911,113 probably null Het
Psmd1 C T 1: 86,128,238 P774L probably damaging Het
Ranbp17 A T 11: 33,297,340 probably null Het
Rptn A G 3: 93,397,670 D770G possibly damaging Het
Serac1 A G 17: 6,050,812 L439P probably damaging Het
Slitrk6 TTTTAGTCTGTTCTACCAACACCTT TTT 14: 110,749,825 probably null Het
Sox6 T C 7: 115,597,509 I295M probably benign Het
Sulf1 T A 1: 12,859,413 D301E probably benign Het
Tas2r117 G A 6: 132,803,051 V51I possibly damaging Het
Tbx2 C T 11: 85,834,735 R171C probably damaging Het
Tgfbr1 A G 4: 47,402,955 I320V probably benign Het
Tmprss2 T C 16: 97,599,260 N4D possibly damaging Het
Tnfaip3 T C 10: 19,007,323 N165D probably benign Het
Tnfrsf21 A T 17: 43,037,911 Y138F probably benign Het
Utp4 T C 8: 106,906,185 S267P probably benign Het
Wnk1 A T 6: 119,963,367 L803* probably null Het
Zbbx T A 3: 75,136,487 D35V probably damaging Het
Zscan12 T G 13: 21,368,574 N189K possibly damaging Het
Other mutations in Tjp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Tjp3 APN 10 81273865 missense probably benign
IGL01739:Tjp3 APN 10 81278656 missense probably benign 0.09
IGL02826:Tjp3 APN 10 81273689 missense probably damaging 0.98
IGL03145:Tjp3 APN 10 81283688 missense probably benign 0.05
R0561:Tjp3 UTSW 10 81273840 missense probably benign
R0562:Tjp3 UTSW 10 81280555 missense probably damaging 0.99
R1099:Tjp3 UTSW 10 81273823 missense probably benign
R1618:Tjp3 UTSW 10 81276260 unclassified probably benign
R1786:Tjp3 UTSW 10 81278054 missense possibly damaging 0.52
R1955:Tjp3 UTSW 10 81277999 missense probably damaging 1.00
R2107:Tjp3 UTSW 10 81280544 missense possibly damaging 0.67
R2130:Tjp3 UTSW 10 81278054 missense possibly damaging 0.52
R2131:Tjp3 UTSW 10 81278054 missense possibly damaging 0.52
R2132:Tjp3 UTSW 10 81278054 missense possibly damaging 0.52
R2133:Tjp3 UTSW 10 81278054 missense possibly damaging 0.52
R2178:Tjp3 UTSW 10 81280107 missense probably benign 0.17
R3054:Tjp3 UTSW 10 81280507 missense probably benign 0.13
R3055:Tjp3 UTSW 10 81280507 missense probably benign 0.13
R5470:Tjp3 UTSW 10 81279547 missense probably benign 0.04
R5645:Tjp3 UTSW 10 81278620 splice site probably null
R5918:Tjp3 UTSW 10 81277912 missense probably benign 0.01
R6108:Tjp3 UTSW 10 81281146 missense probably benign
R6245:Tjp3 UTSW 10 81277276 missense probably benign 0.02
R6300:Tjp3 UTSW 10 81281117 nonsense probably null
R7686:Tjp3 UTSW 10 81278051 missense probably benign 0.00
R8137:Tjp3 UTSW 10 81273691 missense probably benign 0.00
R8240:Tjp3 UTSW 10 81273807 missense probably benign 0.06
R8317:Tjp3 UTSW 10 81280490 missense probably benign 0.11
Z1176:Tjp3 UTSW 10 81281109 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCAGGTTGGAAAGCCTCAG -3'
(R):5'- GCTTGGAAAACCAAGTCCTG -3'

Sequencing Primer
(F):5'- GCCTGTGATTCCAACATTCAAGTGG -3'
(R):5'- CTTGGAAAACCAAGTCCTGTAAAG -3'
Posted On2019-06-07